Geography High School

Does the timing of a tsunami affect its impact?

Answers

Answer 1

As soon as a tsunami approaches the coast, its speed decreases considerably. This is because the speed of a tsunami depends on the depth of the water; the lesser the depth of the water, the lesser the speed of an approaching tsunami. However, there is no change in the overall impact of a tsunami.

Answer 2

Answer:

yes it does##################

Related Questions

Name the phases of the moon and write which one is the first one.

Answers

Answer; Lunar Phase  and new moon

I hope it will help you

what are the elements of a landscape​

Answers

Color
Line
Form
Texture
Hope this helps

What are some of the jobs that geographers have??

Answers

Answer:

Environmental consultant.

Cartographer.

Town planner.

Geographical information systems officer.

Conservation officer.

Landscape architect.

Teacher/lecturer.

Politics or non-profit organizations.

Other Questions
Add the two functions. f(x) = 3x3 + 7x 26 g(x) = x + 2 Please help! Thank you! Find the area of the white region in the diagram shown. what is the mRNA in TACCGGATGCCAGATCAAATC? a cup of coffee is left to cool inside a room and its cooling can be described by the function y = 85(.75)x/5 + 15 where x is time in minutes and t is the temperature of the coffee in degrees celsius. Help!!! I do not seem to understand this problem well. Dr. Seals borrows $15,000 to remodel her backyard. The interest rate is 3%. The interest is compounded twice a year for two years. Why would an investor want to choose a certificate of deposit over a corporate bond Please help help me please ASAP I am begging someone please No links or files describe how the state of Washington and its residents played a huge part in winning World War II? Plzzz help NEED THIS FAST!!! What's the circumference of a circle with a radius of 10 inches Explain the lifecycle of mosquito in short A 45 foot ladder is set against the side of a house so that it reaches up 27 feet. If Latanya grabs the ladder at its base and pulls it 3 feet farther from the house, how far up the side of the house will the ladder reach now? (The answer is not 24 ft.) Round to the nearest tenth of a foot. Layla is going to invest $5,200 and leave it in an account for 15 years. Assuming the interest is compounded monthly, what interest rate, to the nearest tenth of a percent, would be required in order for Layla to end up with $13,800? fateful journey what elements of the story did he invent? And what did he alter ? Most Americans consume a varied diet. They eat foods that are both plant- and animal-based. Which words are clues to the meaning of the word consume? A. are both B. eat foods C. animal-based D. Most Americans plz no bit.yl stuff, just answers Sickle cell anemia is a disease that affects the circulatory system.It can be passed from parent to child. Which of the following indicates the significance of this disease?A.It shows that a disease can cause genetic changes.B.It is a reflection of how genetic factors affect health.C.It shows how public health is affected by environmental factors.D.It indicates how a toxin can play a role in the development of disease. Find the surface area of this prism.Round to the nearest tenth. why is it important to save energy in our daily lives Solve for x. Round your answer to the nearest tenth (one decimal place).