Don uses a funnel to pour oil into his car engine. The funnel has a radius of 6 cm and a slant height of 10 cm. How much oil, to the nearest cubic centimeter, will the funnel hold.

Answers

Answer 1
This funnel will hold approximately  2387.61    the volume of oil that the funnel can hold is approximately  2387.61 ?

Related Questions

Mrs. Smith is shopping for a toy chest to go
in her kids' playroom. She looks at the options
shown.


How much floor space will toy chest A take up?

Answers

Answer: 20ft

Step-by-step explanation:

floor space is only worried about the area of the base, so A would be 4*5 or 20

Answer:

20

Step-by-step explanation:

ANSWER THE QUESTION FOR BRAINLIEST

Answers

Non linear means not a straight line so answer C or the third answer.

Answer:

not a straight line

Step-by-step explanation:

Linear has the word "line" in it. A linear relation has a graph shaped like a straight line.

Nonlinear means "not like a straight line".

Answer: not a straight line

Please I beg of you answer this question please answer this correctly no links no trolls pleaseeee

Answers

Answer:

Step-by-step explanation:

pi r^2 for area

pi 35^2

pi1225= about 3848.45

2pi r for circumference

2pi35

pi70= about 219.9

PLEASE HELP FAST I WILL GIVE YOU BRAINLIEST
AABC - AQRS
Find the missing side length, n.
R
B.
12.5
5
2
А-
-C
4
10
n = [?]
Enter

Answers

Answer:

5

Step-by-step explanation:

yoy need to find hue multiplying factor, this is done by dividing one of the sides in QRS, by one in ABC. you can divide 10 by 4 to give you 2.5, and then multiply that by 2 to get 5

plzzzz help meeeeeeeeeeee

Answers

It is the 2nd one you’re welcome

thomas has 12 more marbles than twice the number of marbles Andrew has.
Andrew has x marbles. which expression represents how many marbles thomas has?
A. x + 2 + 12
B.x+12(2)
C.2x+12
D.2(x+12)​

Answers

Answer:

A.

x + 2 + 12

Step-by-step explanation:

Thomas (t) = Andrew (x) * 2 + 12

Put the lowest number on the left 2 0 -3 -4

Answers

Answer:

-4, -3, 0, 2

Step-by-step explanation:

Answer:

-4,-3,0,2 :p ...........

ANSWER ASAP PLS

The circular opening of a tunnel has a circumference of 36 meters. Which equation can be used to find d, the
diameter of the tunnel opening in meters?

Answers

D = circumference divided by Pi

D = 36 divided by 3.14

D = 11.5

The volume of this rectangular prism is 53.72 cubic centimeters . what is the value of y?

Answers

Answer:

y = 1.7 cm

Step-by-step explanation:

V= lwh

w = [tex]\frac{V}{lh}[/tex] = [tex]\frac{53.72 cubic centimeters}{4cm(7.9cm)}[/tex] = 1.7 cm

A customer at the store wanted to buy a different watch that was listed at $88 but had a 15% discount. Then the customer had to pay a sales tax of 5% on the discounted price. How much did the customer pay for the watch? *

Answers

Step-by-step explanation:

88 X 0,15 =....

... X 1.05 = answer

Raymond bought wrapping paper that cost
$0.04 per square inch. How much did it cost to
wrap this box.

Answers

Answer: $46.08

Step-by-step explanation:

Find the surface Area of the box

the bases are 12*12= 144 times 2 bases 144*2= 288

The area of each side is 12*18=216 times 4 sides 216*4=864

add the totals together to find the total surface area 288+864=1152

total surface area is 1152 inches. Multiply by the cost per square inch

1152*.04= 46.08

the measure of an angle and its complements are 13x and 17x write an equation then solve​

Answers

Step-by-step explanation:

Aal kimoya iyah I love 18

find the slope of each line​

Answers

Answer:

(1,1) and (2,-4)

Step-by-step explanation:

i supposed each line is 1,2,3,4,5 because it is not given the graph numbers but I hope it could help

The National Assessment of Educational Progress (NAEP) includes a "long-term trend" study that tracks reading and mathematics skills over time, and obtains demographic information. In the 2012 study, a random sample of 9000 17-year-old students was selected.24 The NAEP sample used a multistage design, but the overall effect is quite similar to an SRS of 17-year-olds who are still in school. In the sample, 51% of students had at least one parent who was a college graduate. Estimate, with 99% confidence, the proportion of all 17-year-old students in 2012 who had at least one parent graduate from college.

Answers

Answer:

The 99% confidence interval estimate for the proportion of all 17-year-old students in 2012 who had at least one parent graduate from college is (0.4964, 0.5236).

Step-by-step explanation:

In a sample with a number n of people surveyed with a probability of a success of [tex]\pi[/tex], and a confidence level of [tex]1-\alpha[/tex], we have the following confidence interval of proportions.

[tex]\pi \pm z\sqrt{\frac{\pi(1-\pi)}{n}}[/tex]

In which

z is the zscore that has a pvalue of [tex]1 - \frac{\alpha}{2}[/tex].

Sample of 9000, 51% of students had at least one parent who was a college graduate.

This means that [tex]n = 9000, \pi = 0.51[/tex]

99% confidence level

So [tex]\alpha = 0.01[/tex], z is the value of Z that has a pvalue of [tex]1 - \frac{0.01}{2} = 0.995[/tex], so [tex]Z = 2.575[/tex].

The lower limit of this interval is:

[tex]\pi - z\sqrt{\frac{\pi(1-\pi)}{n}} = 0.51 - 2.575\sqrt{\frac{0.51*0.49}{9000}} = 0.4964[/tex]

The upper limit of this interval is:

[tex]\pi + z\sqrt{\frac{\pi(1-\pi)}{n}} = 0.51 + 2.575\sqrt{\frac{0.51*0.49}{9000}} = 0.5236[/tex]

The 99% confidence interval estimate for the proportion of all 17-year-old students in 2012 who had at least one parent graduate from college is (0.4964, 0.5236).

Shelia's measured glucose level one hour after a sugary drink varies according to the normal distribution with μ = 132 mg/dL and σ = 11.3 mg/dL. what is the level L such that there is probability only 0.01 that the mean glucose level of 5 test results falls above L?

Answers

Answer:

134.6

Step-by-step explanation:

Problems of normally distributed samples are solved using the z-score formula. This is X when Z has a p-value of 1-0.01 = 0.99. So it is X when Z = 2.325.

The level is L = 134.6

The Central Limit Theorem estabilishes that, for a random variable X, with mean  and standard deviation, large sample size can be approximated to a normal distribution with a mean and standard deviation

write a mathematical equation and calculate the area of the irregular polygon

Answers

3)5/6)=x 36-508-7392

PLZ ANSWER QUIKCLY
Which expression is equivalent to -12(3x-3/4)

-36x-8

-36x + 8

-36x-9

-36x +9

Answers

Answer:

Last one, -36x+9.

Explanation: You need to multiply negative times positive which is negative. But look at the last one -12×-3/4 equals positive 36/4 which equals 9.

Which graph represents a direct variation?

Answers

I don't know all of them I guess since I can't see the graphs

Answer:

The graph of the direct variation equation is a straight line through the origin.

Step-by-step explanation:


The functions f and g are defined as follows.
g(x) = -2x3-5
f(x) = - 4x + 2
Find f (6) and g(-3)
Simplify your answers as much as possible.

Answers

Answer:

f(6) = -22, and g(-3) = 49

Step-by-step explanation:

f(x) = -4x + 2

f(6) = -4(6) + 2

f(6) = -24 + 2

f(6) = -22

I assume the 3 in g(x) = -2x3 -5 is cubed

g(-3) = -2(-3)^3 - 5

g(-3) = -2(-27) - 5

g(-3) = 54 - 5

g(-3) = 49

=[tex]\frac{mv^{2} }{2}[/tex] ; Solve for v.

Answers

Answer:

[tex]v=\sqrt{\frac{2E}{m} }[/tex]

Step-by-step explanation:

[tex]E=\frac{mv^2}{2}[/tex]

[tex]2E=mv^2}[/tex]

[tex]v^2=\frac{2E}{m}[/tex]

[tex]v=\sqrt{\frac{2E}{m} }[/tex]

giving brainliest!! *easy*

Answers

Answer:

370 square millimeters

Step-by-step explanation:

2x9x5=90

2x10x5=100

2x10x9=180

90+100+180=370 square millimeters

Answer

450mm^3

Step-by-step explanation:

the picture has the workings

A=l×w×h

A=10mm×9mm×5mm

A=450mm^3

at a football game, every person is either a fan of the home team or of the visiting team. omar observes that the ratio of fans of the home team to fans of the visiting team is 7:2. omar states that the total number of fans at the game must be an odd number because 7 + 2 = 9 and 9 is an odd number.

Determine a number of fans of the home team and a number of fans of the visiting team that show omar statement is false.

the first question is, enter a number of fans of the home team that would show Omar's statement is false.

the second question, enter a number of fans of the visiting team that would show omar statement is false.



pls I need help!!!!!!​

Answers

14 fans for the home team and 4 for the away will still hold the ratio and prove Omar’s statement false.

Pls Help! Put a proper answer! If you put a link I will report you!
When clearing the fractions in the equation below, what is the Least Common Denominator?

Answers

Step-by-step explanation:

X - ⅙X = - ½ - ⅓ ==> ⅚X = - ⅚ ==> X = -1

What is 74 in standard form? O A. 11 OB. 28 Oc. C. 2, 401 O O D. 16,384​

Answers

Answer:

oc2

Step-by-step explanation:

because

How many kilograms are equal to
54,308 grams?

Answers

Answer:

54.308 kilograms

Step-by-step explanation:

What is an equation of the line that passes through the point (-5,-2) and is
parallel to the line x - y = 5?

Answers

Answer:

[tex]y=x+3[/tex]

Step-by-step explanation:

What we need to know

Linear equations are typically organized in slope-intercept form: [tex]y=mx+b[/tex] where m is the slope of the line and b is the y-intercept (the value of y when the line crosses the y-axis)Parallel lines have the same slope

1) Rewrite the equation x - y = 5 into slope-intercept form and identify the slope

[tex]x - y = 5[/tex]

Subtract both sides by x

[tex]x - y -x= -x+5\\-y= -x+5[/tex]

Divide both sides by -1

[tex]y= x-5[/tex]

Now, we can tell clearly that the slope (m) of this line is 1. Therefore, a line parallel to this would also have a slope of 1.

Plugging 1 as m into [tex]y=mx+b[/tex], we get:

[tex]y=x+b[/tex]

2) Find the y-intercept (b) of the line parallel to [tex]y= x-5[/tex] and find the final equation

[tex]y=x+b[/tex]

Plug in the given point (-5,-2)

[tex]-2=-5+b[/tex]

Add 5 to both sides

[tex]-2+5=-5+b+5\\3=b[/tex]

Therefore, the y-intercept of this line is 3. Now, plugging this back into our original equation, we get:

[tex]y=x+b\\y=x+3[/tex]

I hope this helps!

Evaluate the expression when a = 6 and x = -3.
-a+7x

Answers

Answer:

-27

Step-by-step explanation:

The equation -a+7x, when plugged in shows -6+7*(-3).

This gives us -6-21 which is -27.

By the way can you follow me on Brainly?

Thanks!

Determine what type of solution the following equation has: 3(x-1)+5=3x+2

- No solution
- One solution
-Infinitely Many solution

Answers

If I’m not wrong it’s one solution because the sum of 3(x-1)+5=3x+2 is 0

Hope this helps!

3. A savings account has a 3% interest rate. (a) Complete the ratio table shown. Show your work. Deposit ($) 100 50 300 Interest ($) 3 12 6 36 (b) How much more interest would you have if you deposited $200 than if you deposited $150? Show your work.

Answers

Answer:

Wait what

Step-by-step explanation:

Will give brainliest for correct answer

Answers

Answer:

A function is a rule that assigns to each input exactly one output.

Step-by-step explanation:

If you have more than one of the same inputs for multiple outputs, it would create a vertical line at somepoint on your line.

Answer:

The correct answer is "a rule that assigns to each input exactly one output".

Step-by-step explanation:

In mathematics, a function is a binary relation between two sets that associates to each element of the first set exactly one element of the second set. Typical examples are functions from integers to integers, or from real numbers to real numbers.

Other Questions
In the circular flow model, businesses provide goods and services to whichpart of the economy?A. BusinessesB. Product marketsC. Resource marketsO D. Households Please help! Thank you! what is the mRNA in TACCGGATGCCAGATCAAATC? Help!!! I do not seem to understand this problem well. Why would an investor want to choose a certificate of deposit over a corporate bond Layla is going to invest $5,200 and leave it in an account for 15 years. Assuming the interest is compounded monthly, what interest rate, to the nearest tenth of a percent, would be required in order for Layla to end up with $13,800? Most Americans consume a varied diet. They eat foods that are both plant- and animal-based. Which words are clues to the meaning of the word consume? A. are both B. eat foods C. animal-based D. Most Americans plz no bit.yl stuff, just answers Sickle cell anemia is a disease that affects the circulatory system.It can be passed from parent to child. Which of the following indicates the significance of this disease?A.It shows that a disease can cause genetic changes.B.It is a reflection of how genetic factors affect health.C.It shows how public health is affected by environmental factors.D.It indicates how a toxin can play a role in the development of disease. why is it important to save energy in our daily lives Red and white blood cells are produced inside the __________ of bones. This is an interaction between the skeletal, circulatory, and immune systems.A. MarrowB. Spongy BoneC. Compact BoneD. Liver This Question: 1 pt20 of 20This QuthThe pH of a fruit juice is 2.9. Find the hydronium ion concentration, [H30 * ), of the juice. Use the formula pH = -log[H30*]The hydronium ion concentration [H30 + ] is approximately moles per liter.(Use scientific notation. Use the multiplication symbol in the math palette as needed. Round to the nearest tenth as needed.) A worldwide organization of academics claims that the mean IQ score of its members is 118, with a standard deviation of 17. A randomly selected group of 40 members of this organization is tested, and the results reveal that the mean IQ score in this sample is 115.8. If the organization's claim is correct, what is the probability of having a sample mean of 115.8 or less for a random sample of this size When riding your bike on a main road you should always follow the rules of the _________.roadbikers guidewalkerstown they are riding in Can someone please help me on this plz I beg u :( Writing: Critique On Nutrition And Pregnancy. Critique a current article or website on Pregnancy and compare to good nutrition practices. 1) Evaluate the recommendations. 2) Compare the recommendations. Write a 300 or more on your findings and conclusions. ( Will Mark Brainliest). Mhanifa Plz help me with this thank you! Need help on doing escape room. How to escape from Emoji Planet. What is one service the Freedmen's Bureau provided for African Americans?The agency provided funds to pay poll taxes.The agency set up courts to settle land disputes.The agency taught them how to cultivate crops.The agency found employment in Northern cities. Which of the following is a proportion? 5. Consider kite HIJK. If HK = 8 and HP = 5, find KP.H.