Drag each incentive to the correct location on the chart.
Nick has been hired as the marketing director of a sporting goods manufacturing company. Classify his new job incentives as monetary or nonmonetary.
salary increase
flexible work schedule
commission on every sale
stock options
reduced work hours
friendly coworkers

Answers

Answer 1

Answer:

Monetary incentives have to do with cash compensation whereas non-monetary incentives do not include cash but rather work on providing a fulfilling experience for the employee. Research indicates that both are necessary for job satisfaction.

Monetary Incentives

Salary increaseCommission on every saleStock options.

Non-monetary incentives

Flexible work schedule Reduced work hours Friendly coworkers.

Related Questions

What caused the Triangle Shirtwaist Factory Fire of 1911 to end in so many deaths?

A: negligence by the factory's owners and city officials
B: workers' tendency to ignore safety procedures
C: the city's reluctance to fully fund its fire departments
D: a lack of training on safety procedures

Fairly certain it’s A, but I want to be sure since it’s a final.

Answers

Answer:

A: negligence by the factory's owners and city officials

Explanation:

Answer:

A: negligence by the factory's owners and city officials

Why did trade groups like the Hanseatic League form?
O A. To combat illness among traders
B. To levy high taxes on traders
C. To avoid the danger of North Africa
O D. To reduce the threat of attacks
SUE

Answers

Answer:

D. To reduce the threat of attacks

Explanation:

The Hanseatic League protected merchants and traders so merchants wouldn't get attacked. Merchants and artisans formed guilds to protect their members from competition. The merchant guild prevented outsiders from doing business in towns. It was established by merchants in Germany to protect the guilds' economic interests and the trade routes which the merchants used.

Someone help me with this assignment I will give Brainliest

Answers

Answer:

1. Absolute rulers punished anyone who spoke out against them. This of course created tensions among the people. Absolute rulers have been know to be corrupt and to work for self gain. This would mean having oneself own interest instead of country. This would cause good shortages, leading many to die. An example of this are. under the czars rule in the 1800s. The czar forced more exports when tbe country was in a great famine; causing much destruction.

2. Events such as oppression as well as corruption and unfair payments can cause an individual to want change. An example is the Salt March. Gandhi led the march to collect salt. Salt was used very widely and was only sold through the british at very high taxes. This prompted Gandhi to want to change the taxation system placed on locals.

3. Conservatives generally want the government should play a smaller role in regulating buisnesses as well as managing the economy. Liberals support individual rights such as civil rights and human rights. As well as free markets and free trade.

4. Liberals usually want to establish individual right while radicals cultural reform as well as social reform.

5. Absolute rulers would punish anyone who went against them. in forms of protests, manifestos, speeches, or riots. Absolute rulers did not allow for individual freedom. This allowed for the ruler to keep tight control over tbe people.

Question 7 of 10
Which of the following should you provide to anyone writing a college
recommendation letter for you?
A. Your political beliefs
B. General information
C. Your achievements
Ο Ο
D. Your religious beliefs

Answers

the answer is C your achievement

Answer:

c. Your Achievements

Explanation:

Why was Cambdia dragged into the Vietnam war?

Answers

Answer:

Vietnam launched an invasion of Cambodia in late December 1978 to remove Pol Pot. Two million Cambodians had died at the hands of his Khmer Rouge regime and Pol Pot's troops had conducted bloody cross-border raids into Vietnam, Cambodia's historic enemy, massacring civilians and torching villages.

Explanation: Here you go! I searched this up btw it was on a website called bbc.com. I hope this helped and have a wonderful day!

Why was the Maginot line created in France? no links short answer

Answers

Answer: The Maginot Line was built to fulfill several purposes: To prevent a German surprise attack. To deter a cross-border assault. To protect Alsace and Lorraine (returned to France in 1918) and their industrial basin.

Explanation:

~Hope This Helps You!

Answer:

Explanation:

This French line of defense was constructed along the country’s border with Germany during the 1930s and named after Minister of War André Maginot. It primarily extended from La Ferté to the Rhine River, though sections also stretched along the Rhine and the Italian frontier. The main fortifications on the northeast frontier included 22 large underground fortresses and 36 smaller fortresses, as well as blockhouses, bunkers and rail lines. Despite its strength and elaborate design, the line was unable to prevent an invasion by German troops who entered France via Belgium in May 1940.

The Maginot line was named after Andre Maginot (1877-1932), a politician who served in World War I until wounded in November 1914. He used crutches and walking sticks for the remainder of his life. While serving after World War I as France’s minister of war and then as president of the Chamber of Deputies’ Army Commission, he helped complete plans for the defensive line along the northeastern frontier and obtain funds to build it.

The main fortifications of the Maginot line extended from La Ferte (thirty kilometers east of Sedan) to the Rhine River, but fortifications also stretched along the Rhine and along the Italian frontier. The fortifications on the northeast frontier included twenty-two huge underground fortresses and thirty-six smaller fortresses, as well as many blockhouses and bunkers. The French placed most of their largest fortresses in the northeast because of their desire to protect the large population, key industries, and abundant natural resources located near the Moselle valley

The first attack by the Germans against the Maginot line itself occurred on May 16, 1940, and was directed against the isolated fortifications at La Ferte on the extreme western tip of the line. The Germans managed to capture the casemates only after four days of hard fighting, and with the support of large amounts of heavy artillery and high-velocity 88-mm fire. Despite the use of massive force, the Germans failed to capture a single major fortress before the armistice on June 25. Though designed to withstand attacks from Germany, the Maginot line fortresses could be defended against attacks from the rear; consequently, the Americans had no easy task fighting their way through the line in 1944-1945.

How did this bill gates bulid his business?

Answers

In 1970, at the age of 15, Gates and Allen went into business together, developing "Traf-o-Data," a computer program that monitored traffic patterns in Seattle. ... Gates and Allen contacted the company, proclaiming that they were working on a BASIC software program that would run the Altair computer.

what did not contribute to the fall of the Mughal Empire?

Answers

Answer: A. slave Trade

Explanation:

Even though the slave trade continued under the Mughal empire, it was not very widespread and was limited so could not have contributed to the fall of the empire.

The empire however, was known to engage in extravagant spending such as when emperor Shah Jahan built the very expensive and renowned Taj Mahal simply to house his wife's dead body.

To pay for this spending, the empire imposed unpopular taxes that led to widespread discontent and rebellion. Added to this was the occasional forced conversions of people of other religions to Islam which was drew contempt from the population and hastened the decline of the empire.  

what does the Louissanna purchase suggest the goal of the manifest destiny​

Answers

The Louissanna Purchase was one of Americas largest purcases from france and covered most of the midwest and western parts! When this happened it let people realize how big of a country and society could have been made which is a goal that represents manifest destiny.

A hypothesis is ____

Answers

Answer:

An educated guess

Explanation:

You don't know for sure, but your educated guess is that THAT's what it is.

Hope this helps :)

Answer:

An educated  guess about an observation

Explanation:

please mark brainliest

What event led the Truman administration to expand the containment doctrine to include Asia?

withdrawal of the French from Indochina
formation of the Vietcong in Vietnam
surrender of Japan to end World War II
communist takeover of mainland China

Answers

Answer:

surrender of Japan to end World War II

Explanation:

The event led the Truman administration to expand the containment doctrine to include Asia was surrender of Japan to end World War II.

Answer:

The formation of the Vietcong in Vietnam.

Explanation:

Which of the following actions may Congress take to advance civil rights?

Answers

Answer:

The debate over these issues that began in the late-nineteenth century continues, In The Civil Rights Cases (1882), the Supreme Court struck down, that the Fourteenth Amendment, by its very terms, prohibits only state action.” the view that Congress can use its power under Section Five to expand rights.

Explanation:

To prevent one person from having too much power, a president is limited to four terms of year(s) each. This term limit was created by .

Answers

Answer:

the 22nd Amendment lollll

Answer:

The Framers of the Constitution gave the President the power to veto acts of Congress to prevent the legislative branch from becoming too powerful

Explanation:

Generals are usually judged by how successful they are in battle. By this measure George Washington was not a very good general, fighting nine battles and winning only three. But what other important contributions did Washington make that helped the Americans win the war and establish a lasting republic

Answers

The correct answer to this open question is the following.

The important contributions that Washington made that helped the Americans win the war and establish a lasting republic were the following.

General George Washington was considered to be a good leader. Yes, he was a person who could inspire and rally his troops under the most difficult conditions. And he took these traits to the presidency of the United States, and that is how he became the successful first President of the United States for two periods and had the respect of Federalists and Antifederalists that were part of his cabinet.

Let's have in mind that as the General of the Continental Army during the Revolutionary War, Washington faced many problems. Among them,

the lack of money, problems of transportation, inexperienced army, and poor organization.

General George Washington knew the Continental Army soldiers were poorly trained and had minimum combat experience. That is why Washington called the help of Prussian military Official Baron Von Steuben during the winter of 1778 in Valley Forge. This Prussian military really helped to train the American troops.

Actions like these helped him to be considered a great leader.

In the late 1960s, what did members of the counterculture share with many other American citizens?
a respect for police officers
a disrespect for all authority figures
a concern about the Vietnam War
an opposition to private ownership

Answers

Answer:

C. a concern about the Vietnam War

Explanation:

In the late 1960s, the members of the counterculture share with many other American citizens the "concern about the Vietnam War."

The Vietnam war which lasted for about 20 years, beginning in 1955 and ended in 1975, saw the northern Vietnamese go against the South Vietnamese.

Then, with the American involvement lasting more than they had envisaged after committing themselves to take a side in the war, the counterculture movements and American society in general, joined together to express their desire to end the Vietnam War.

Answer:

c

Explanation:

What social change resulted from the Industrial Revolution?

Answers

Answer:

Rapid urbanization, or the movement of people to cities, was a result of the Industrial Revolution. Farming changes, soaring population growth, and an ever-increasing demand for employees prompted a massive migration from fields to cities.

OAmalOHopeO

The English withdrew from France, ending the Hundred Years' War, after facing a revitalized French army under the leadership of:_________.

Answers

Answer:

Jean Bureau

Explanation:

You see he do thing with artillery it go bang bang Talbot go die die.

World history 01.09 module exam

Answers

Answer:

is this a question ? ........

PHÂN TÍCH NHỮNG ĐẶC ĐIỂM CƠ BẢN CỦA VĂN MINH PHƯƠNG ĐÔNG CỔ TRUNG ĐẠI?

Answers

Văn hóa phương Đông bao gồm Châu Á và Trung Đông, trong khi thế giới phương Tây bao gồm Nam và Bắc Mỹ, các nước Châu Âu, New Zealand và Australia. Phương Đông và phương Tây có nhiều điểm khác biệt dựa trên nền văn hóa của họ, điều này được phản ánh trong thái độ và hành vi của con người.


What was a major difference between Deng Xiaoping's and Mao Zedong's
policies as the leaders of the People's Republic of China?
A. Deng Xiaoping banned all forms of Western media, while Mao
Zedong encouraged Westernization in China.
B. Deng Xiaoping hoped to destroy Chinese traditions, while Mao
Zedong defended traditional Chinese culture.
C. Deng Xiaoping promoted free market policies, while Mao Zedong
opposed noncommunist economic systems.
D. Deng Xiaoping called for open elections in China, while Mao
Zedong was a dictator with absolute power.

Answers

Answer:

C

Explanation:

Deng Xiaoping promoted free market policies, while Mao Zedong

opposed noncommunist economic

A major difference between Deng Xiaoping's and Mao Zedong's policies as the leaders of the People's Republic of China is that Deng Xiaoping called promoted free market policies, while Mao Zedong opposed noncommunist economic systems. Therefore, the option C holds true.

What is the significance of difference between Deng Xiaoping and Mao Zedong?

The economic conditions of the People's Republic of China were different under the different leaders that had held the position of administrative control in the region. Some helped in economic advancements, while the conditions went lower due to some.

Some leaders like Deng Xiaoping promoted free market policies and also opened up the gates for international trade. Whereas, the economic conditions under Mao Zedong, did not prove to be developing for the society, as he followed strict communism policies under economy.

Therefore, option C holds true significance of difference between Deng Xiaoping and Mao Zedong.

Learn more about Deng Xiaoping and Mao Zedong here:

https://brainly.com/question/24144150

#SPJ5

Who was the first American to orbit the earth?
John Shepard
John Glenn
Bill Armstrong
O Neil Armstrong

Answers

John Glenn I believe is the answer

Answer:

John Glenn

Explanation:

The main role of women in Sparta was to

Answers

Spartan women will be shown to have played a significant role in society, the economy, culture, and even the state’s politics. women were primarily trained to be mothers, who produced strong and healthy male children for the good of the state. Females played a crucial role in the enforcement of Spartan values, especially the family members of warriors.

What is the best way to describe this clause?
oked
O It is dependent because it has a subject and a verb.
O It is independent because it has a subject and a
verb
O It is dependent because it expresses a complete
thought
O It is independent because it expresses a complete
thought.

Answers

Answer:

The sentence is an independent clause because it is formed in a way to express a complete and whole thought. An independent clause includes a subject and a verb, as well as expresses a full thought with feelings attached. If it were a dependent clause, it would not contain a working verb and subject.

Explanation:

Hope this helps

It is independent because it expresses a complete thought  is the best way to describe this clause. Hence, option D is correct.

What is a clause?

The fact that the sentence is structured to represent a complete and coherent concept makes it an independent clause. An independent clause expresses a complete thought with feelings connected and has a subject, a verb, and both a subject and a verb. The subject and working verb would not be present if it were a dependent sentence. The types of clause are main clauses, subordinate clauses, coordinate clauses and adjective clauses.

A clause is the complete sentence and independent sentence in which there is no need of putting any other words. It has a subject and a verb in the sentence, like Rahul is eating dinner, He was playing with the basketball.

Thus, option D is correct.

For more details about clause, click here:

https://brainly.com/question/19711531

#SPJ6

what was slaverys greatest protection, according to Douglass?​

Answers

Answer:

The Constitution's biggest flaw was in protecting the institution of slavery. Many constitutional provisions did this. Article 1, Section 9, prohibits Congress from banning the importation of slaves until 1808, and Article 5 prohibited this from being amended.

Which outcome is the most likely result of the government lowering taxes on
a particular good?
A. Supply of the good will increase.
B. Supply of the good will decrease.
ООО
C. Demand for the good will remain the same.
D. Demand for the good will decrease.

Answers

A) Supply of the good will increase

Explanation: I THINK when taxes go down the prices of items would decrease therefore, more people will want to buy that item or it would cost less to manufacture this item and the manufacturer would be able to make more.

Answer:

Supply of the good will increase.

Explanation:

Who is the first american president?

Answers

Answer:

george washington is the first president

Answer:

George Washington was the first president of USA

I hope it helps

have a great day

[tex]#Liliflim[/tex]

help me plss plsssssss​

Answers

Answer:

just some that I guess aren't alrdy answered in the other posts

Deep devotion to or extreme pride in one’s nation

Answers

Answer:

deep devotion for one's country

Ones country is the constitution

Why was the Union victory at Vicksburg important?
O A. It led to Confederate General Lee being fired.
B. It allowed the Union to control the Mississippi River.
C. It caused France and Great Britain to come to the aid of the Union.
O D. It convinced the president of the Confederacy to surrender.

Answers

answer:

B

it allowed the union to control the mississippi river.

Answer:

B

Explanation:

A victory at the siege of Vicksburg, Mississippi, in 1863 gave the Union control of the Mississippi River in the American Civil War

The Supreme Court case mcculloch v. Maryland ensured that:

Answers

Answer:

Answer to the following question is as follows

Explanation:

One amongst first and most significant Supreme Court decisions on federal authority is McCulloch v. Maryland (1819). The Supreme Court has ruled in this instance that Congress had implied powers based on those specified in Article I, Section 8. The "Necessary and Appropriate" Clause empowered Congress to create a national bank.

Other Questions
From the top of the leaning tower of Pisa, a steel ball is thrown vertically downwards with a speed of 3.00 m/s. if the height of the tower is 200 m, how long will it take for the ball to hit the ground? Ignore air resistance. Suppose that the speeds of cars travelling on California freeways are normally distributed with a mean of miles/hour. The highway patrol's policy is to issue tickets for cars with speeds exceeding miles/hour. The records show that exactly of the speeds exceed this limit. Find the standard deviation of the speeds of cars travelling on California freeways. Carry your intermediate computations to at least four decimal places. Round your answer to at least one decimal place. Express this sense sequence as a polypeptide. Use the three letter abbreviation and separate the amino acids with a dash - e.g. Trp-Thr-Ala. If there is a stop codon - you may add an asterisk to the sequence - e.g. Trp-Thr-Ala-* ATTTTAGCCATGCCCGGGAAAATACGCCGCCCTCCCGGTACACCATTGTTCGGCAAATAAAAATAAAAT polypeptide sequence [answer1] what is the DNA sequence of the 5' UTR? [answer2] what is the RNA sequence of the 3' UTR [answer3] Please help!!!hi,can you please help me with this?thanks Help Me please!!!!! Rn calculate the mass in 4.05*10^22 molecules of calcium phosphate Which event is inferred by most scientists to be responsible for a climate change that has recently led to a decrease in the size of most glaciers? * a decrease in the rate of divergence of lithospheric plates along a mid-ocean ridge O a decrease in the amount of insolation reaching Earth's surface an increase in the amount of greenhouse gases in Earth's atmosphere an increase in the amount of vegetative cover in the tropics How is an ammeter connected in a circuit to measure current flowing through it? A skier of weight 700 N is pointed down a ski hill that has a slope angle of 25 above horizontal.What is the component of his weight pulling him down the slope.O 634NO 326NO 296NO 700N The following is a comprehensive problem which encompasses all of the elements learned in previous chapters. You can refer to the objectives for each chapter covered as a review of the concepts.Note: You must complete part 1 before completing part 2.Based on the following data, prepare a bank reconciliation for December of the current year:a. Balance according to the bank statement at December 31, $283,000.b. Balance according to the ledger at December 31, $245,410.c. Checks outstanding at December 31, $68,540.d. Deposit in transit, not recorded by bank, $29,500.e. Bank debit memo for service charges, $750.f. A check for $12,700 in payment of an invoice was incorrectly recorded in the accounts as $12,000.Enter all amounts as positive numbers.Kornett CompanyBank ReconciliationDecember 31, 2014SubtotalAdjusted BalanceDeductAdjusted Balance Simplify (2x^2 + 4x) - (7x - 3x^2 + 5) A shipping carton is in the shape of a triangular prism. The base area of the triangle is 6 inches squared and the the height of the prism is 15 inches. how many cubic inches of space are in the carton? Very tired1) The professor (teach)five classes Monday. He (be)afterward2) You (feed)the birds that we saw yesterday. Some of them (be)cardinals.first on the trail Saturday, because he (know)the way3) Andy (go)better than we did.4) The house (be)dirty after they left. We (clean)it yesterdaythe motorcycles in the garage, then they (eat)5) The boys (put)lunch6) My friends and I (find)some gold in the river. Then we (look)formore.7) 1 (like)to write poetry when I (be)eight years old.8) Charlotte and I (see) lightening in the sky Thursday night; the storm (come)fast.9) The children (go)to the park yesterday. They (stay)for two hoursoutside after it (snow)Three inches of snow (fall)10) We (play)that dayI need to past simple tense?? does anyone know the quotient of x and y Dichotomous key (PLZ HELPLPP) Chrysanthenone is an unsaturated ketone. If Chrysanthenone has M+ = 150 and contains 2 double bond(s) and 2 ring(s); what is its molecular formula? Enter the formula in the form CH first, then all other atoms in alphabetical order; do not use subscripts. The formula is case-sensitive. someone help me pleaseeeeee Which of the following describes the end behavior of the function (x) = 5x3 + 3x2 + x 9?A) As x , y + and as x +, y B) As x , y and as x +, y +C) As x , y and as x +, y D) As x , y + and as x +, y + ASAP WILL MARK BRAINLIEST! NO LINKS PLEASE ,DUE IN 5 MIN! Using an order of magnitude analysis, estimate the total textbook expenditures incurred by all engineering majors at National University per year