Drag each tile to the correct box. COOL PICS
Arrange the organisms from fastest to slowest based on the time they’d take to complete the 20th Carnegie stage.





mouse
baboon
chicken
human
sheep

Drag Each Tile To The Correct Box. COOL PICSArrange The Organisms From Fastest To Slowest Based On The
Drag Each Tile To The Correct Box. COOL PICSArrange The Organisms From Fastest To Slowest Based On The

Answers

Answer 1

Answer:

Fastest- chicken

mouse

sheep

baboon

Slowest-human

Explanation:

Answer 2

Answer:

Fastest- chicken

mouse

sheep

baboon

Slowest-human

Explanation:


Related Questions

Which statement best explains the myth about how Romulus and Remus founded Rome?

Answers

After deciding to build a town on one of seven hills, Romulus and Remus had to decide which hill to base it off of and Romulus chose Palatine hill and Remus chose Aventine Hill, Later leaving Romulus to kill Remus in a fight and build the city on Palatine hill hence the name Rome.

Answer: Romulus defeated his brother, then founded Rome on one of the seven hills.

Explanation: Despite there is no answer choices, I'm thinking back on a little quiz I took, and it had the same exact question with the same exact answer choices, and that was the correct answer

Which of these is an advantage of fossil fuels? *

O Reliable
O Large reserves
O Greenhouse gas emissions
O Non-renewable





Answers

Answer:

reliable

Explanation:

Explanation:

Fossil fuels are a non-renewable resource.

Most stars seem to move across the night sky because
a. the universe is expanding
b.the universe is getting smaller
c. Earth is orbiting the Sun
d. Earth is spinning on its axis

Answers

I think it is C but uh if its not D Hope this helps-

Explanation: because

which of the following is problem created when a cell becomes to large

Answers

Answer:

As a cell increases in size, it usually does not make extra copies of DNA. If a cell became too large, an "information crisis" would occur. The cell has more trouble moving enough nutrients and wastes across the cell membrane.

Explanation:

Can you tell me which go where?

Answers

Answer:

heredity goes to the first one

phenotype at the second one

Explanation:

Which factor makes enzymes well-suited to the role of catalyst in a biochemical reaction?

A)Enzymes do not affect the energy of a reaction.

B)Enzymes slow down reactions so products can form.

C)Enzymes can be reused because they do not permanently bond with substrate.

D)Enzymes can only bind to other enzymes so the same product is formed each time.

Answers

Answer: C

Explanation: Once an enzyme binds to a substrate and catalyzes the reaction, the enzyme is released, unchanged, and can be used for another reaction.

Enzymes can be reused because they do not permanently bond with substrate.

What are Enzymes?

A biological catalyst called an enzyme is usually always a protein. It accelerates a certain chemical reaction in the cell. The enzyme is continuously employed during the reaction and is not destroyed. Each enzyme molecule found in a cell is unique and tailored to a particular chemical reaction.

Proteins called enzymes assist our bodies' chemical reactions move forward more quickly. For several processes, including digestion and liver function, enzymes are crucial.

Health issues might result from having too much or too little of a specific enzyme. Healthcare professionals can also use the enzymes in our blood to look for injuries and illnesses.

Therefore, Enzymes can be reused because they do not permanently bond with substrate.

To learn more about Enzyme, refer to the link:

https://brainly.com/question/14953274

#SPJ6

There are many different types of cells with many different types of cellular structures and functions. Which of these structures is found in all types of eukaryotic cells?
A. chloroplast
B. cell wall
C. nucleus
D. centrioles​

Answers

Answer:

nucleus

Explanation:

chloroplasts and cell walls are only found in plant (and fungi) cells, while centrioles are only in animal cells.

The structure that is found in all types of eukaryotic cells is the nucleus. The correct option is C.

What are eukaryotic cells?

Eukaryotic cells are those cells that contain true cell organelle. These cells are present in the higher organism, and they perform complex functions like replication, mitosis, etc.

There are two types of cells. They are prokaryotic and eukaryotic cells. Prokaryotic cells are those that do not contain an organelle and a nucleus. They are present in smaller organisms.

The nucleus is the brain of cells. It controls all functions of cells, and it contains the genetic material of the organisms. In prokaryotic cells, the nucleus is absent and in eukaryotic cells, the nucleus is present. That is the difference between them.

Thus, the correct option is C. nucleus.

To learn more about eukaryotic cells, refer to the link:

https://brainly.com/question/982048

#SPJ6

Why are some theories more widely accepted than others such as the theory of evolution?

Answers

Answer:

Scientific theories is accepted as a scientific truth, supported by evidence collected by many scientists. The theory of evolution by natural selection is a classic theory. Keeping in mind a Hypothesis is a possible answer to scientific questions.

Explanation:

I majored in Biology

How is the rock in the deep mantle similar to the rock in the parts of the mantle nearest the surface? How is it different?

Answers

Answer:

Rocks within the mantle contain more magnesium and iron than the ones in the crust. Difference: Rocks in the deep mantle are under intense heat and pressure.

Electron transport from complex I to complex IV pumps more protons than transport from complex II to complex IV.
With this in mind, which will produce more ATP

A. Transport from complex I produces more ATP.

B. Transport from complex II produces more ATP.

C. Both produce the same amount of ATP.

Answers

Answer:

A

Explanation:

ATP synthase uses a proton gradient to make ATP. Since transport from complex I creates a larger proton gradient, it also produces more ATP.

Electron transport from complex I produces more ATP.

ELECTRON TRANSPORT CHAIN:

The electron transport chain, ETC, is the third and last stage of aerobic cellular respiration. It produces the highest molecules of ATP in cellular respiration.

The ETC involves the transfer of electrons to series of molecules in order to create an electrochemical gradient needed for ATP synthesis.

The electron transport chain is made up of four complexes namely: Complex I, II, III and IV. NADH and FADH2 produced in the Krebs cycle are the electron carriers.

Complex I pumps more hydrogen ions (H+) from the mitochondrial matrix to the intermembrane space.

Since the pumped is directly related to the number of ATP molecules, complex I will produce more ATP molecules.

Learn more: https://brainly.com/question/442662?referrer=searchResults

There is a lot of talk about gaps in the fossil record. This means that we do not necessarily have fossils for every organism that has ever lived. What do you think could account for these gaps in the fossil record?

Answers

Answer:

Explanation:

The rate decomposition of dead remains, to a large extent, determines whether there would be fossils left of the organism after it has been long gone or become extinct. Environmental factors (such as harsh weather condition and early insect invasion of dead remains) could increase the rate of decomposition of dead remains which could really make it difficult for fossils to be available for such organisms under these factors (especially if the organism is restricted to a particular region by nature) .

20 points and will mark brainliest! Please explain how you got it though

Answers

Answer:

crossing over during meiosis

Explanation:

i just had biology last semester hope this helps

Which statement is true about gold and helium?
A. They both occur as a gas at room temperature.
B. They are both made of subatomic particles.
C. They are both used in balloons.
D. One of made of protons and the other of only electrons.

Answers

Answer:

The answer is B

B. They are both made of subatomic particles.

Which is the source of energy, which drives the water cycle?

Answers

Answer:

it's the sun

Explanation:

the water cycle is driven primarily by the energy from the sun

The charged particles in the beams that Thomson studied came from atoms. As these particles moved away from their original atoms, they formed a visible beam. The current model of the atom includes protons, neutrons, and electrons.

What is the best use of an atomic model to explain the charge of the particles in Thomson’s beams?

An atom’s negative particles are surrounded by positive matter, so the positive particles are easier to remove.
An atom’s positive particles are surrounded by negative matter, so the negative particles are easier to remove.
An atom’s smaller negative particles are at a distance from the central positive particles, so the negative particles are easier to remove.
An atom’s larger positive particles are at a distance from the central negative particles, so the positive particles are easier to remove.

Answers

The question to the above information is;

What is the best use of an atomic model to explain the charge of the particles in Thomson's beams?

Answer;

An atom's smaller negative particles are at a distance from the central positive particles, so the negative particles are easier to remove.

Explanation;

-Atoms are comprised of a nucleus consisting of protons (red) and neutrons (blue). The number of orbiting electrons is the same as the number of protons and is termed the "atomic number" of the element.

J.J. Thomson discovered the electron. Atoms are neutral overall, therefore in Thomson’s ‘plum pudding model’:

atoms are spheres of positive chargeelectrons are dotted around inside

Answer:

Its C on edge

Explanation:

write the code for RNA from this DNA STRAND :

AAAAAATTTTTTCCCGGGGTTTATATATC

Answers

Answer:

UUUUUUAAAAAAGGGCCCCAAAUAUAUAG

Explanation:

All you have to do is apply the same concept as DNA, but T (Thymine) is replaced with U (Uracil)

How many chlorine atoms are there in the molecule NiCl2

Answers

Answer:

2, that’s what the 2 means.

Explanation:

HURRY. Why is transcription said to be unidirectional?

Answers

Answer:

Transcription is unidirectional because you are copying only ONE side of the DNA. Remember that DNA is a double stranded helical structure. One strand of DNA is complementary to the other strand.

Explanation:

What is the purpose of the other tube of water?

Answers

Explanation:

cant see photo

Answer:

delude the other thing

there is no picture so i have no idea what your asking. ill edit this answer to be more specific when you explain

Explanation:

PLEASE HELP
Fact vs. Opinion
Read each statement and decide if it is a fact (can be proven with evidence) or an opinion (personal belief).
8. Different cell types also have special duties, like building skin or bone, pumping out hormones, or making antibodies.
9. Animal cells are more interesting than plant cells.
10. Proteins are processed and lipids are manufactured in the smooth endoplasmic reticulum and Golgi apparatus.

Answers

Answer:

8 fact 9: opinion 10: fact

Explanation:

Answer:

8. Fact

9. Opinion

10. Fact

HELP ASAP
Joe is experimenting to determine which liquid will cause bean plants to grow faster. He watered the plants with equal amounts of liquid and measured their height every other day. The plants are in the same pots with different soils and placed in the same location. Will Joe be able to obtain reliable data to write a supported conclusion?
Yes, because he is only observing the height of the plant.
Yes, because he is consistent with watering the plants.
No, because he used different soils.
No, because he uses only one type of plant.

Answers

Answer:

No, because he used different soils.

Explanation:

which liquid will cause bean plants to grow faster.

He watered the plants with equal amounts of liquid and measured their height every other day.

The plants are in the same pots with different soils and placed in the same location.

Ok so last statement made the experiment wrong.

As a constant variable the soil should be the same for all plants only the liquid should change

which describes a eukaryotic cell,but not a prokaryotic cell?

Answers

Answer is c it is surrounded by cell membrane

How does evolution result in reproductive success?

Answers

Answer:

Often when species evolve, they receive a trait that may make them live longer or make it where their survival chances are significantly increased. Which in turn can make their offspring stronger and able to live longer, therefore increasing their population.

If the food on the island is small seeds, what finch is best adapted? Explain why

Answers

Answer:Adaptation in Darwins Finches. Beak depth, which is correlated with body size and the ability to crack larger seeds, varies according to drought conditions: plants produce fewer, harder seeds in dry years and more, softer seeds in wet years. Only larger birds with deeper depths survive in drought years.

Explanation:

“Fish and other wildlife become unhealthy and die without __________.”

Oxygen
Carbon Dioxide
Eutrophication

(This is 7th grade science)

Answers

Answer:

Oxygen

Explanation:

Andwer is oxygen if not then eutrophication

A dead organism takes matter out of the ecosystem cycle and that matter
can never be used again. *
O True
False

Answers

Answer:

Decomposers break down dead organisms into nutrients and gases so that they can be used by other organisms. Nutrients can enter or exit an ecosystem at any point and can cycle around the planet.

Answer:

False

Explanation:

help need answer asap !!

Answers

Wet is irrigation Forest is paper preserving aesthetic value is park trapping sediments as water

Helpppppppppppppppppppppppppppppppppp

Answers

Answer:

umm i dont understand your question

Explanation:

What is the atomic mass of Sulfur that has 18 neutrons?

Answers

Answer:  32.066 atomic mass units

B is the correct option.

Which objects have the most eccentric orbits?
A. Uranus and Neptune
B. Jupiter and Earth
C Saturn and Venus
D. Mercury and Pluto

Answers

Pluto and mercury is the correct answer
Other Questions
PLS HELP!!! due to inflation nominal prices are usually there were to demand increases. After the second increase the price for a certain item was twice as big as the original. By what percent was the first increase, if the second increase was 25% Look at the pictures and solve. WILL GIVE BRAINIESTDrag the tiles to the correct boxes to complete the pairs. Not all tiles will be used.Match each graph to the equation of its line. A bus traveled at a constant speed of 80 km/h. How long did it take the bus to travel 40 km? What are the 5 causes of social problems and evils? ago 7.156710. Which of the following could be theperimeters of the three squares below?A. 12 ft, 16 ft and 20 ftB. 20 ft, 16 ft and 24 ftC. 40 ft, 80 ft and 120 ftD. 16 f1, 24 ft and 28 ftManeuvering the Middle LLC, 2017 One quart of milk costs $1.05 and 1 gallon of milk costs $3.89. Which is a better buy? Explain. ILL GIVE BRAINLEIST Read this introductory paragraph from a student essay and then answer the question.(1) Have you ever felt great fear but decided to face that fear anyway? (2) There is no single definition of courage and more than one way to show it. (3) In Heart of a Samurai, Manjiro is faced with grave dangers. (4) In The Boy Who Harnessed the Wind, William must overcome disbelief and ridicule. (5) Both heroes show tremendous courage.Which choice best revises sentence 4 so that it contains supporting details?In The Boy Who Harnessed the Wind, William must overcome disbelief and ridicule, which is extremely difficult for him at this point in his life.In The Boy Who Harnessed the Wind, William must overcome the disbelief and ridicule of his neighbors to complete his passion project, building a windmill.In The Boy Who Harnessed the Wind, William must overcome disbelief and ridicule, which is something we all must do at points in our lives.In The Boy Who Harnessed the Wind, William must overcome disbelief and ridicule, and read books about windmills in a language he does not know very well. Neap tides occurs in Read the summary paragraph for the article on service and answer the question that follows:Service improves society, impacting the helpers as wel as those neoding assistance.It means being an active partcjpant in one's community, taking actionwhere it can be of benefit. Every person should make it a prionity to serve at least two hours per week. It's an extremely important civic responsibility that isinvaluable to citizens most in need. Service creates improved comnmunities where people care about each other.Which of the following makes a true statement about good summaries?Good summaries include the writer's opinion on the article.Good summaries focus on the support details from the body.Good summaries provide all the data an author uses for support.Good summaries objectively restate the thesis and crucial details. Read the selection and the question, and then choose the option that best answers the question.Si se da usted un golpe en la espalda, puede escuchar las recomendaciones del doctor:Cudese mejor si quiere sanar.Descanse por una semana.Lave la herida bien con agua para no tener picor.No cubra la herida.According to the text, what would not be a good idea?- Air the wound-Apply more water as needed-Going back to work today-Relaxing for seven days Anyone know the answer? 50 points !!!!!!!!!!!!!! answer the question please help I will give bairnleast What are the 2 largest schools of Buddhism Find the measure of angle b (15 By rounding each of 9.85, 3.875 and 6.3 to the nearest whole number work out an estimate for the answer to 9.85^3 / 3.875 + 6.3^2 Someone please help! No one every answers my questions :( Melanie works at a frozen yogurt stand after school. The stand sells fruit and yogurt smoothies for $3.00 each and soft-serve cones for $2.00 each. On a hot summer day, the stand sold 12 more smoothies than soft-serve cones for total sales of $206. Which of the following systems of equations could be used to find ss, the number of smoothies, and cc, the number of cones the shop sold that day? the integers -10 and 10 are= Finance Bank receives a check drawn on the account of Enterprise Inc., one of thebank's customers, at 3 P.M. Friday. Dora, the presenter of the check, is not one ofthe bank's customers. The bank uses deferred posting with a 2 P.M. cutoff hour. If itdecides to dishonor the check, it must do so by midnighta. SaturdayO b. Sunday.O c MondayOd Tuesday Read the passage from the myth of Romulus and Remus.The founding of Rome revolves around two orphan boys named Romulus and Remus. Legend says that the boys were raised by a mighty wolf. The boys mother was murdered by an evil king named Amulius. The king then threw the two babies into the Tiber River. They washed up onto the banks of the river, where the wolf found them. Seeing the crying babies, she took pity on them. She gently picked them up in her teeth. She took the babies to her cave and fed them. She cared for them for years. The boys grew bigger and stronger. Eventually, a herder found the boys and took them home. He and his wife raised the boys. The boys decided to build a city where the wolf had fed them. However, Romulus and Remus fought over whom the gods favored. In this fight, Romulus killed Remus. Then Romulus founded Rome.What role does the wolf play in the founding of Rome?She builds the city.She kills the founder.She constructs the wall around the city.She rescues the boy who becomes the founder.