Answer:
your body will react
Explanation:
I have the Sickle cell trait....
uh anyways- ( HOPE THIS HELPS).
5. The lion researchers in the film have studied 20% of the park and identified 41 lions. (Show your
work/justify your answer for each section.)
a. The entire Gorongosa park is 4,000 km². Approximately how large (in km) is the portion of
the park that has been studied?
ASAP PLSS
Answer:
800 km²
Explanation:
If the researchers have studied 20% of the 4000 km² park, to find out how much of the park in km they have studied, all you have to do is find 20% of 4000.
4000 x .20 = 800
800 km² is your answer.
If the area of the entire Gorongosa park is 4,000 km². Among which, 20% of the park is already studied, it means 800 [tex]km^2[/tex].
What do you mean by the researcher?A researcher may be defined as a kind of person who significantly carries out academic or scientific research in order to find some unrevealed data and information.
According to the question,
The total area of Gorongosa park = Gorongosa park is 4,000 km²
The area which is already studied = 20%.
Now, you have to find the area that is already studied in km. So, you have to calculate the 20% of 4,000 km².
The area which is already studied = 4000 × .20 = 800 [tex]km^2[/tex].
Therefore, if the area of the entire Gorongosa park is 4,000 km². Among which, 20% of the park is already studied, it means 800 [tex]km^2[/tex].
To learn more about Researchers, refer to the link:
https://brainly.com/question/28136063
#SPJ2
Which atom is involved in giving your heart energy to beat?
O carbon
O gold
O oxygen
O iron
Answer:
Oxygen
Explanation:
-How fast the heart beats depends on the body's need for oxygen-rich blood. At rest, the SA node causes your heart to beat about 50 to 100 times each minute. During activity or excitement, your body needs more oxygen-rich blood; the heart rate rises to well over 100 beats per minute.
-The heart, like any organ, requires blood for oxygen and other nutrients so it can do its work. The heart does not gather oxygen or nutrients from the blood flowing inside it. Instead, it receives blood from coronary arteries that eventually carry blood into the heart muscle.
Please also describe how actin-binding sites are made available for cross-bridging with myosin heads during contraction.
Answer: The calcium ion binds to troponin, and this slides the tropomyosin rods away from the binding sites.
Explanation:
Contraction and relaxation of muscle cells brings about movements of the body. The contractile myofilament called sarcomeres are bounded at each end by a dense stripe called the Z - line, to which the myosin fibres are attached, and lying in the middle of the sarcomere are the actin filaments, overlapping with the myosin.
When action potential spreads from the nerve along the sarcolemma (muscle cell membrane), it penetrates deep into the muscle cell through the sarcoplasm (cytoplasm of muscle cell), and releases CALCIUM from the intracellular stores.CALCIUM triggers the binding of myosin to the actin filament next to it forming CROSS BRIDGES.
For this to occur, ACTIN BINDING SITE has to be made available. TROPOMYOSIN is a protein that winds around the chains of the actin filament and covers the myosin-binding sites to prevent actin from binding to myosin. The first step in the process of contraction is for calcium ions to bind to troponin so that tropomyosin can slide away from the binding sites on the actin strands.
23. In both plant and animal cells, the cell
membrane
(1) produces enzymes
(2) controls reproduction
(3) is composed of sugars
(4) regulates diffusion
Answer:
the answer is option 1
The Cell membrane regulates diffusion, in plants and animal cells.
What is a Cell Membrane?Every biological cell has a thin membrane that separates it from the rest of the environment this membrane is known as a cell membrane.Cell membranes is made of lipids and proteins.The cell membrane's chemical nature makes it extremely flexible, making it a perfect border for quickly growing and dividing cells.Cell membrane is a semi-permeable membrane.Cell membrane does not produce enzymes.
Hence, the option (1) is incorrect.
Cell membrane cannot control reproduction.
Hence, option (2) is incorrect.
The main constituents of cell membrane is lipids and proteins, not sugars.
Hence, option (3) is incorrect.
Cell membrane regulates diffusion, because the cell membrane contains the semi-permeable membrane which allows only lipids and certain small molecules in the cell.
Hence, option (4) is correct.
Therefore, the Cell membrane regulates diffusion, in both plants and animal cells.
Learn more about the Cell Membrane here: https://brainly.com/question/14290615
#SPJ2
What are chromosomes? How are they different between prokaryotes and eukaryotes?
Answer: A chromosome is a long DNA molecule with part or all of the genetic material of an organism. The primary distinction between these two types of organisms is that eukaryotic cells have a membrane-bound nucleus and prokaryotic cells do not
Explanation:
Chromosomes are long thread of DNA molecule. Prokaryotes have one chromosomes while eukaryotes have many.
Chromosome:
It is a long thread of DNA molecule as a part of genetic material of all living organisms.
In prokaryotes, DNA is not very much compacted.Only one chromosome is usually scene in prokaryotes.In Eukaryotes, Chromosome are very compacted and form an special structure.Multiple chromosomes are found in Eukaryotes.
Therefore, chromosomes are long thread of DNA molecule. Prokaryotes have one chromosomes while eukaryotes have many.
To know more about Chromosomes,
https://brainly.com/question/296477
I Will Give BRIANIEST
A scientist tests the water in a local pond and finds that it has a pH of 7.9.
What is true about the water sample?
Choose 1 answer:
(Choice A)
A
It is basic.
(Choice B)
B
It is acidic.
(Choice C)
C
It is neutral.
(Choice D)
D
It is both basic and acidic.
Answer:
it is Basic brooooooo. No B NOT C AND NOT D. oNly A
The answer is A. The ph of regular water is about 7.0 or so. so since it's 7.9 it means it's basic. You're welcome :)
**anatomy & physiology question**
if you are at a 60X magnification and the field diameter is 3.2mm an object that's about 1/4th the size of the field diameter what is the size of the object?
Answer:
0.8mm.
Explanation:
If the size of an object is about 1/4th the size of the field diameter so the size of an object is 0.8mm because the fourth part of field diameter is equals to 0.8mm. Due to knowing field diameter of microscope we can calculate the real size of objects that is too small which can't be seen with the naked eye. So one fourth part of field diameter is equal to 0.8mm.
What is seed dispersal? Name some agents of seed dispersal
Answer:
The Process by which seeds spread over a wide area is known as seed dispersal..
some agents
Air
water
animals
etc..
Answer:
Seed dispersal is the movement, spread or transport of seeds away from the parent plant.
The most common methods are :
wind, water, animals, explosion and fire.
In which experimental set up shown would you expect the Elodia plant inside a test tube to produce the least amount of oxygen
Answer:
Due to less concentration of carbondioxide gas.
Explanation:
Elodia plant inside a test tube produces the least amount of oxygen due to limited carbondioxide gas that is necessary for photosynthesis process. If a test tube has less amount of carbondioxide gas which is a reactant in photosynthesis so in the end the Elodia plant generates less amount of glucose as well as oxygen while on the other hand, if there is more carbondioxide gas is available to Elodia plant, more oxygen as well as glucose is produced.
Which best describes the blood flowing in an artery?
A. It is oxygen rich
B. It contains no red blood cells.
C. It moves toward the heart.
D. It is oxygen poor.
It is oxygen rich
What do you mean by arteries?
The arteries are the blood vessels that deliver oxygen-rich blood from the heart to the tissues of the body. Each artery is a muscular tube lined by smooth tissue and has three layers: The intima, the inner layer lined by a smooth tissue called endothelium.
What is oxygenated blood?
Oxygenated blood can be simply defined as a blood cell with large percentage of oxygen and low in carbon dioxide. It appears bright red in color and travels away from the heart to different parts of the body.
To learn more about arteries here
https://brainly.com/question/3306673
#SPJ2
please help with this question
Answer:
a -5
d -2
c-3
b-4
e - 5
Explanation:
I'm guessing this is the answer
Answer quickly please
How do roundworms differ from earthworms?
A. They have a cylindrical body.
B. They have a body that is tapered at both ends.
C. They reproduce sexually.
D. They are not divided into segments.
Answer:
Key difference: Earthworms, Tapeworms and Roundworms are long and cylindrical shaped worms. The basic difference between them is that Earthworms are segmented invertebrates belonging to the phylum Annelida, Tapeworms are flatworms belonging to the phylum Platyhelminthes, and Roundworms are parasitic worms belonging to the phylum Nematoda.
Explanation:
So: A?
Answer:
A
Explanation:
They have a cylindrical body.
Have a great day and good luck
TACTTAGAGGCACCACATGGGCCTTGCACT to mRNA
Answer:
I don't know the answer
Explanation:
is is this even a question cos I don't think so.
Order the levels of organization of living things. (Order the levels starting from top to bottom with the smallest at
the top)
biome
species
biosphere
population community
ecosystem
WILL GIVE BRAINLIEST
HELP QUICK HELP ILL MARK U BRAINLIST
Answer:
B or A I think B
A stimulus is anything that causes a reaction or response. What is an example of an outside stimulus and an inside stimulus?
Answer:Stimulus: any change in an organism's environment that causes the organism to react. It is a fancy way of saying “cause”. Example: An animal is cold so it moves into the sun.
Explanation:
Answer:
hi
Explanation:
any change in an organism's environment that causes the organism to react. It is a fancy way of saying “cause”. Example: An animal is cold so it moves into the sun.
uses of crush in the farm
Answer:
ok i dont understand what that is
Explanation:
triangular shaped land mass found on land
Answer:
beautiful
Explanation:
serioudly I like it
Zara had a birthday and was able to choose a pet. The pet that she chose was a beautiful clownfish named Bozo, a common salt water fish. Zara already has a tank with goldfish at home. Use your knowledge of diffusion & osmosis to tell Zara how to take care of Bozo.
Answer:
See the answer below
Explanation:
The advice I would give to Zara would be that she should keep Bozo in a separate tank with common salt water away from the goldfish. Bozo is a salt water fish while the goldfish can only survive in freshwater.
If Bozo is kept in a saltless water/freshwater tank with the goldfish, the water would be hypotonic to Bozo. Consequently, water will osmotically diffuse into the cells of Bozo, the cells would become turgid and lyse, and this would lead to the death of the fish.
If the goldfish is kept in the same salt water tank with Bozo, the salt water would be hypertonic to the goldfish. Consequently, water will osmotically diffuse out of the cells of the goldfish into the surrounding salt water, the cells of the goldfish would become flaccid, and this would lead to the death of the fish.
What causes ocean tides to reach higher up on a shore at certain times of day than at others? A. The moon's gravity and Earth's rotation B. The ocean's conveyor belt and refraction C. Earthquakes and volcanoes O D. Temperature and salinity differences
Answer:
A
Explanation:
I read about ocean tides. the Moon has an effect on the ocean which causes the ocean to bulge toward the Moon. When the Moon is in alignment with the sun the ocean bulges out more because of the added gravity. The Moon though smaller than the sun has more gravitational pull than the sun.
Earth makes one full rotation on its axis approximately every 24 hours. If Earth's period of rotation decreased to 20 hours, which of the following changes would occur?
There would be fewer days in a week.
The length of nighttime would increase.
It would take Earth longer to revolve around the Sun.
The length of daylight and nighttime would decrease.
Answer:
The length of daylight and nighttime would decrease.
Explanation:
If 24 hours was decreased to 20, it would shorten night and day time.
FIND THE INDEPENDENT & DEPENDENT VARIABLE!
- the amount of iron in blood depends on the amount of red meat a person eats.
Answer:
The answer is:
Independent: red meat eaten by a person
Dependent: iron in the blood
Explanation:
A dependent variable has to depend on something else, so in order for a dependent variable to exist or happen, there has to be the independent variable. The independent variable is something that does not need anything else to happen for it to take place. It s independent. Such as, a mother cannot have a child without sperm. The mother have a child is dependent, where the sperm is independent.
PLEASE HELP IM GIVING 50 POINTS FOR THIS!!!!!!!! ALSO BRAINLIEST
Plan a controlled experiment that uses the simulation to investigate how changing the mass of an object changes its acceleration. The net force on the object must stay the same. Record your plan here.
It is possible to measure how acceleration changes with mass by throwing objects with different mass from the same height and measuring the acceleration.
What are the important factors for the experiment?This experiment requires you to measure how acceleration changes if the mass changes. This implies you need to consider the following factors:
Acceleration: This factor is the one you will measure in your experiment.
Mass: This factor is the one you will need to control, this implies using objects from different masses and comparing if mas has any effect on acceleration.
Other: Net force, wind, etc. are other factors that need to be constant to prevent them affect the results.
Steps for the experiment:
Choose a specific heigh: One of the ways of measuring acceleration is to throw objects and determine the acceleration as they fall, so the first step will be to establish a height.
Throw different objects with different masses: You can begin with light objects and move into heavier objects.
Measure acceleration: Every time you throw an object, measure acceleration using the formula A = change in velocity/ time.
Learn more about acceleration in:
brainly.com/question/12134554
#SPJ1
1.How does Nitrogen cycle through the enviroment?
2. Trace the steps that carbon cycles from plants,animal,and enviorment?
Answer: 1. The nitrogen cycle is a biogeochemical cycle.
2. The carbon cycle is a biogeochemical cycle.
Explanation:
1. The nitrogen cycle can be defined as the biogeochemical cycle in which the atmospheric nitrogen is utilized by the plants which is fixed by the soil bacteria. The nitrogen becomes the part of the biosphere as plants utilize it as an important development mineral. The nitrogen cycle involves the nitrogen fixation in which plants fix nitrogen by the help of bacteria into ammonia, nitrification in which the ammonia is converted into nitrite, nitrogen assimilation in which the plants assimilate and utilize the nitrogen for their growth and development, and denitrification involves the reduction of nitrite into atmospheric nitrogen. The conversion of nitrogen is carried out via physical and biological processes.
2. The carbon cycle involves the atmospheric carbon dioxide being circulated in plants as they utilize it for photosynthesis. The carbon dioxide is fixed by the plants in the form of carbohydrate which is consumed by the animals and on decomposition of plants and animals dead matter release carbon dioxide gas to the atmosphere. This allows the recycling of the carbon dioxide gas in the environment.
how did advancements in technology help scientists better understand process of cell division?
Answer:
As is true for many fields of research, cell biology has always been ... Thanks to these advances we now have access to microscopes and ... You might then also realize that the new method, at least on paper, may have additional applications. ... which makes the technology attractive to yet more scientists.
Explanation:
Hoped I helped you out please mark me brainliest!!!
With the creation of the microscope, humans were able to observe plant and animal cells, and as technology advanced, scientists were able to learn more about these various types of cells.
What is a microscope?A microscope is a device that can be used to examine small objects, including cells. The image of an object is magnified in the microscope by at least one lens.
In most cases, the light is focused on the sample by passing it through a condenser.
After passing through the sample, the light passes through the objective lens, which magnifies the image of the sample, and then to the oculars, where the enlarged image is viewed.
The discovery of the green fluorescent protein (GFP), the development of increasingly sophisticated microscopes, and the development of in vitro assays that faithfully reproduce cellular functions are just a few examples of technological advances that have fueled many areas of cell biology.
Thus, it can be concluded that the advancements in technology help scientists better understand process of cell division.
For more details regarding microscope, visit:
https://brainly.com/question/18661784
#SPJ2
To find new and alternative farming methods and practices, private companies often fund their own research and development teams.
False
True
Answer:
FALSE ALL DAY LONG
Explanation:
George Washington Carver was particularly interested in the products of what foods?
O Peanuts, sweet potatoes, soy
Peanuts, tobacco, soy
Peanuts, potatoes, corn
Soy, potatoes, sweet potatoes
Answer:
A - peanuts, sweet potatoes, and soy
Explanation:
Answer:
I looked it up and got peanuts, pecans, sweet potatoes, and soybeans...
Explanation:
What are the possible benefits of hybridization?
Answer:
Advantages of hybridization include passing along favorable traits and prolonging the survival of a threatened or endangered species, but a disadvantage is that hybrid animals have more difficulty finding mates and successfully breeding. Hybridization occurs naturally and through human initiation.
how is cancer cell division different from regular cell division
The picture shows respiratory epithelium in the lungs. The cilia, or fingerlike projections are MOST LIKELY there to
A)
move liquid.
B)
catch debris.
C)
secrete mucus.
D)
transmit impulses
Answer:
B. catch debris in the lungs
