Everywhere was a shadow of death. The farmers spoke of much illness among their families. In the town the doctors had become more and more puzzled by new kinds of sickness appearing among their patients. There had been several sudden and unexplained deaths, not only among adults but even among children, who would be stricken suddenly while at play and die within a few hours.

—Silent Spring,
Rachel Carson

Which is the best comparison of the tone in these passages?

Both passages have a dark, frightening tone.
Both passages have a somber tone, but the second is more somber.
While the first passage has a dark, horrifying tone, the tone of the second is much lighter.
While the first passage has a negative tone, the second has an even more negative tone.

Answers

Answer 1

Answer:

have a dark horrifying tone

Explanation:

:)

Answer 2

Answer:

While the first passage has a dark, horrifying tone, the tone of the second is much lighter.

Explanation:

This was the correct answer.  "Both passages have a dark, frightening tone." was incorrect.


Related Questions

In the fifth paragraph, "tyranny is a sleepless foe" suggests that
1)dictators do not sleep well
2)people have few rights in most countries
3)foreign agents are everywhere
4) the threat of oppression is ever-present

Answers

Answer:

4) the threat of oppression is ever-present, makes the most sense, but I dont have the paragraph so I cant be sure

Explanation:

Answer:

4

Explanation:

Blazing in gold and quenching in purple,
Leaping like leopards to the sky,
Then at the feet of the old horizon
Laying her spotted face, to die;
Stooping as low as the kitchen window,
Touching the roof and tinting the barn,
Kissing her bonnet to the meadow,-
And the juggler of day is gone!
What is personified in this poem?

Answers

Answer:

The Sun is being personified in the poem.

Three major events happen in one day: a Republican politician makes a statement about immigration, a Democratic politician makes a statement about immigration, and a protest group makes a statement about immigration. The producers of the KRSTZ radio program choose to cover only one of these stories. What kind of bias do they show?

inevitable bias
bias by omission and bias by arrangement
bias by omission
unintentional bias
It depends completely on what the events were, so there is not enough information to tell.

Answers

Answer:

inevitable bias

Explanation:

no matter what they did its going to be viewed as some kind of bias

Tell us a time when you helped someone. Describe how your support impacted the other person and how it made it made you feel.

Answers

hi, I hope you’re having a good day :)

One time I personally helped someone was when my mom was really stressed. She went to the store and while she was gone I cleaned the house for her and made her favorite dessert. That way she could relax when she got back home for a bit. This made her feel appreciated and loved

Hope that helps :)

HEY CAN ANYONE PLS ANSWER DIS!!!

Answers

Answer:

It was like old times again. Just me and my bestfriend who I hadn't seen in 5 years. Talking about how much are lives have changed over the years. We start to realize that we don't really have that much in common anymore, we both have new jobs, live in new places, new friends. Its just not the same as when we finished college. Eventually we both get tired of talking about our lives so we finish up and go home, not knowing that would be the last day we ever talked again.

Answer:

it all started when i picked up the wrong suitcase. I had no idea then I had the wrong suitcase. It looked exactly like mine. as I picked up the suitcase I walked to the car line and waited for my parents. as I was standing at the car line i started to smell something so disgusting I was going to jump right back on that plane i came off of. I started to investigate the smell in the air. I walked around and sniffed the security guard as he looked at me funny. was it him that had that  rancid smell? nope! it felt like the smell was just following me around. it was a little breezy so I thought it would be the trash can by the entrance of the airport. I secretly smelled the trash can. it was for sure stinky but it was definitely not it. I saw my parents finally pull up. I put my suitcase in the car and hurried in the car to get away from that smell! as I was sitting in the car I smelled the stinky, rancid, horribly smell again! I thought id never get away from this smell. As we pulled over to find out what the smell was me and my parents went to my suitcase and took a big sniff. OOH BOY! did that suitcase smell bad, and it was for sure the stinky smell I was smelling. I decided to open the suitcase and as I was opening it I was so scared what the smell could be that was in here. I finally opened the suitcase and i was so disgusted, and confused to find out this wasnt my suitcase. this was someone elses suitcase! in this suitcase had dirty underwear, and dirty socks! it was so grows! I wanted to barf. I went to the lost and found and quickly dropped it off and ran back to the car and left.

Explanation:

Read the excerpt from Flannery O'Connor's "The Life You Save May Be Your Own." The ugly words settled in Mr. Shiftlet's head like a group of buzzards in the top of a tree. The simile in this excerpt compares Mr. Shiftlet to a group of buzzards. the ugly words to the top of the tree. a group of buzzards to the top of a tree. the ugly words to a group of buzzards.

Answers

I JUST DID IT, D

Explanation:

EDGE

After analyzing the simile in the excerpt, we can say it compares the following:

D. The ugly words to a group of buzzards.

What is a simile?

A simile is a figure of speech in which a comparison between two different things is made. Similes always rely on words such as "like" and "as" to make the comparison.

In the excerpt, the simile compares two things to other two different things:

Ugly words are compared to a group of buzzardsMr. Shiflet's head is compared to the top of a tree

Since letter D is the only option that presents one of those two possibilities, it is the correct answer.

Learn more about similes here:

https://brainly.com/question/14234454

The idea that in Okonkwo's language, the word for "woman" is also used to describe a man
without power suggests?

Answers

It suggests that men are superior to women and they (men) are the only ones with any power to control things in their society

Consider the video and advertisements that you've seen. Now, write a script to advertise any product of your choosing. The product can be real or fictitious. Use figurative language as a rhetorical device to enhance the persuasiveness of your advertisement. Also, consider your audience. To improve on your advertisement, start by creating an outline, then review and revise your first draft. If you have access to recording equipment, you may also try to record and present your advertisement as a radio spot.

Answers

Explanation:

Remember, the term advertisement simple words, refers to activities done for the purpose of promoting a particular service or product, etc.

Product: Female Cream

Audience: Women and men

Draft Script: "Ever wanted to look younger? Well, no need to wait further. Here comes the all-new 'XYZ' soap. This has been proven and tested to produce results within 1 week of usage. Note: Only limited stocks are available, Order Now!!!."

Answer:

Product: Energy bar

Audience: Kids and parents

AD: “Ever wanted to not buy a bunch of snacks for the kids? What if you only needed to buy one, one that's not full of sugar and horrible for the kids? Try CRUNCH! CRUNCH comes in all flavors filled with nutrients and keeps the kids going for hours. It comes in small disposable bags: Just unwrap it, eat it, and throw it away! Buy CRUNCH for a limited time in stores!!"

Explanation:

PLEASE HELP!!!Select the correct text in the passage.

In his "Four Freedoms" Speech to Congress, President Franklin Roosevelt calls for the end of human oppression and the beginning of universal liberty. Which sentence from the passage best support this analysis?

from Roosevelt's "Four Freedoms" Speech


The first is freedom of speech and expression—everywhere in the world.

The second is freedom of every person to worship God in his own way—everywhere in the world.

The third is freedom from want—which, translated into world terms, means economic understandings which will secure to every nation a healthy peacetime life for its inhabitants—everywhere in the world.

The fourth is freedom from fear—which, translated into world terms, means a world-wide reduction of armaments to such a point and in such a thorough fashion that no nation will be in a position to commit an act of physical aggression against any neighbor—anywhere in the world.

That is no vision of a distant millennium. It is a definite basis for a kind of world attainable in our own time and generation. That kind of world is the very antithesis of the so-called new order of tyranny which the dictators seek to create with the crash of a bomb.

To that new order we oppose the greater conception—the moral order. A good society is able to face schemes of world domination and foreign revolutions alike without fear.

Since the beginning of our American history, we have been engaged in change—in a perpetual peaceful revolution—a revolution which goes on steadily, quietly adjusting itself to changing conditions—without the concentration camp or the quick-lime in the ditch. The world order which we seek is the cooperation of free countries, working together in a friendly, civilized society.

This nation has placed its destiny in the hands and heads and hearts of its millions of free men and women; and its faith in freedom under the guidance of God. Freedom means the supremacy of human rights everywhere. Our support goes to those who struggle to gain those rights or keep them. Our strength is our unity of purpose.

To that high concept there can be no end save victory.

Which sentence best supports this analysis?

A. It is a definite basis for a kind of world attainable in our own time and generation

B. A good society is able to face schemes of world domination and foreign revolutions alike without fear

C. The world order which we seek is the corporation of free countries, working together in a friendly, civilized way.

D. The nation has placed it's destiny in the hands and heads and hearts of it's millions of free men and woman: and it's faith in freedom under the guidance of God.

E. To that high concept there can be no end to slavery.

Answers

The sentence that best supports the analysis is:

D. The nation has placed its destiny in the hands and heads and hearts of its millions of free men and women: and its faith in freedom under the guidance of God.

What is an Analysis?

An analysis is an examination of the facts to reach a conclusion. In the text provided above, we can see that Roosevelt called for the beginning of liberty in the concluding part of his speech.

In the last sentence from which option D was culled, he talked about the freedom of men and women who sought liberty.

Learn more about an analysis here:

https://brainly.com/question/890849

#SPJ1


Write a character sketch of the
scarecrow in the poem In
Morning Dew

Answers

Answer:

Answer to the following question is as follow;

Explanation:

The writer describes the notion to that of a scarecrow, who is hyperaware of everyone else around him. It would actively study and comprehend its environment. It is critical that we have a mindset or thinking of learning something new rather than being afraid to ask questions about topics we don't understand.

n a feeding frenzy, the pigeons descended upon the breadcrumbs that the kindly old man on the park bench continued to toss.

Which is a correct analysis of the sentence?

Answers

Answer:

the pigieons are being nice

Explanation:

c

Read the excerpt.

After a strenuous climb, the hikers decided to make camp before reaching the summit because night was approaching rapidly.

Which statement most accurately describes this excerpt?

It contains two dependent clauses and one independent clause.
It contains one independent clause.
It contains one dependent clause and one independent clause.
It contains one independent clause and two dependent clauses.

Answers

Answer:

Two dependent clauses and one independent

Explanation: After a strenuous climb   is a dependent clause.  It needs an explanation

Answer:

It contains one dependent clause and one independent clause.

Explanation:

Just took the test on edg :)

Write down Questions about why you in particular do something that u do-

Answers

We want what we do to matter

How does the cousin believe the country was affected by the decision to have an open casket funeral?

Answers

Answer:

sorry I don't know the answer

Which country is the island of Socotra part of? from text

Answers

Answer:

Yemen

Explanation:

Socotra sits at the entrance to the Gulf of Aden, only 60 miles from the horn of Africa. Politically it is governed by Yemen, some 230 miles to the north. Geographical isolation has sculpted Socotra in its unique form.

Which line of dialogue from Act III, scene i of Romeo and Juliet most foreshadows that Mercutio’s death will lead to other tragic events in the story?

Benvolio: O Romeo, Romeo! brave Mercutio’s dead;
That gallant spirit hath aspir’d the clouds,
Romeo: This day’s black fate on more days doth depend;
This but begins the woe others must end.
Tybalt: Thou wretched boy, that didst consort him here,
Shalt with him hence.
Prince: Romeo slew him, he slew Mercutio;
Who now the price of his dear blood doth owe?

Answers

Answer:

Tybalt: Thou wretched boy, that didst consort him here,

Explanation:

I think, I mean Tybalt does die then dunhe

Answer:

B- Romeo: This day’s black fate on more days doth depend;

This but begins the woe others must end.

Which two parts highlight the psychological consequences of war?

Answers

Answer:

Quit

Explanation:

Nin

i’m confused what are u supposed to be highlighting

What is the indirect object in the sentence?


I sent her a postcard about my trip.

Answers

The indirect object is “her.”
Who is being sent the postcard? Her.
(The indirect object is to whom or for whom the action of a verb is being performed.)

Read the information in the brainstorming table.

Beginning: First, I signed up to audition for a part in the school play. Middle: Then I recited my lines and sang a short solo for the chorus teacher. End: Blank.

Which piece of information best completes the table?

Every year, the students in our school put on a spring performance.
Finally, the chorus teacher announced there would be a school play.
Then I chose a song and prepared for my audition.
Finally, I was selected for a leading role in the play.

Answers

Answer: is d

Explanation:

In which underlined adjective clause is the relative pronoun used as the object of a preposition?

a The part of Alaska that is within the Arctic Circle is cold most of the year.
b The explorer whom I met last year has never been to the North Pole.
c The climate is one in which little foliage can grow.
d I saw a dog whose sled left without him.

Answers

Answer:

D would be answer I guess

Marijuana and teens facts to put in my essay?

Answers

Answer: Most teens start marijuana as a young kid

Explanation: young kids start smoking early.

Which revision of this section of dialogue best shows the narrator’s feelings? When I open the cover, the smell of fresh paper wafts up to greet me and the crisp, open page fills me with an exquisite sense of possibility. When I first open the notebook, I take care to crease the cover gently so that it’s nice and flexible, and then I can enjoy writing without fussing. I’m happy about the notebook because now I can get started on writing down the song that’s been floundering in my head all week. I’m glad to have a new notebook because I’m hoping it will provide inspiration to start working on that short story that’s due in English soon.

Answers

Answer: When I open the cover, the smell of fresh paper wafts up to greet me and the crisp, open page fills me with an exquisite sense of possibility.

Explanation:

The revision of this section of dialogue best shows the narrator’s feelings is "When I open the cover, the smell of fresh paper wafts up to greet me and the crisp, open page fills me with an exquisite sense of possibility".

This implies how the narrator feels about how he feels like whenever he wants to start a new notebook.

Answer:

its a

Explanation:

Fren bought groceries that cost $14.40 .She paid the store clerk, Ping,with a $20 bill. Ping makes change by saying. 2 pennies make the total $14.40 . 6 dimes makes it $15.00 ,and 6 dollars makes it $20 .

Answers

Answer:

D. yes, ping should give five one dollar bills, not six

Explanation:

Given data is

Fren bought groceries.

The groceries cost = $14.40

She paid to ping (clerk) = $20

hence, the money should give by ping to fern is = $20 - $14.40 = $5.6

two pennies make the total of $14.40 which is true.

six dimes makes $15 this is also true.

six dollars makes $20 this is false.

Since $15 + $6 = $21 which is not equal to $20.

PLEASE HELP
Which phrase best defines “imagery”? writing that is not intended to carry literal meaning images that are literal only, never figurative or imaginative words that trigger the imagination to remember and recombine images paragraphs that have many long words and sentences

Answers

Answer:

I Belive the answer is "Words that trigger the imagination to remember and recombine images"

Explanation:

Im a junior in advanced english and it just makes sense

describe the effect of blank verse in the poem how would the poem be different if frost had used a rhyming form?

Answers

Answer:

^^^^^^^^The use of blank verse makes the poem sound like everyday speech. Blank verse’s regular meter gives the poem a sense of structure and stability. If the poem had a rhyme scheme, it would not sound like people were talking normally. If the poem had a rhyme scheme, the rhyme might be distracting to the reader. Rhyme schemes can sound artificial.

Explanation:

Right on e d g e n u i t y

Answer:

Fitst person is right

Explanation:

got it right on edge

The sun....(shine) by day.
present simple​

Answers

Answer:

shining

Explanation:

**WILL GIVE BRAINLIEST PLEASE HELP**

- flakes of cold snow drifting slowly
- In sequence to make the ground
- their permanent residence

**what poetic device is used by saying the ground is the snow’s ‘permanent residence’

Answers

metaphor?

explanation :

i think its metaphor because ur not really personifying it but ur saying its something that it isnt so i think it is metaphor

Metaphors. I hope i helped :) have a good day :)

1. All his information ..... wrong. (was, are, were)​

Answers

Answer:

well makes more sense with "was" tbh.

All his information "was" wrong.

Explanation:

what does "the peom is structured around an implied contrast" mean

Answers

Answer:

that would just mean the content of whatever poem you are studying is either paradoxical or displays 2 different ideas that prove or emphasise the message.

I am confused on this question pls tell me someone :)

Answers

Answer:

Just answer the question and try to remember what you've learned

Explanation:

Other Questions
Hello help me an answer for this question.How much does the sky weigh? How much does the Earth weigh? which angle is adjacent to 9 ? Which sentence best describes low comedy?A. It places stereotypes at the center of jokes.B. It makes you think about important issues.C. It often includes allusions to historical events.D. It relies on physical antics and silly jokes 3100 times 43 how much is this Which phrase best completes this sentence?Tengo que comprar comestibles. Voy a ___A. limpiar la cocinaB. ir al supermercadoC. pasar la aspiradoraD. lavar los platos Write a 200- to 350-word reflection on your experience after taking the NHA CBCS practice test and completing a focused review. Respond to the following questions in your reflection:Which section(s) of the practice test were you most comfortable with?Based on the content you have covered so far, which section(s) of the practice test do you need to improve on?Which section(s) of the practice test do you have questions about?What is your plan for building your knowledge in the necessary areas? What advice does the first Ms Marvel give to the new Ms Marvel Which explains how the judiciary can remain independent?O A. Justices can change laws to suit themselves.OB. Justices have to be elected to stay on the bench.O c. Justices can be replaced by the president at any time.OD. Justices are given lifetime appointments.Reset hello, how are you doing? ??????????????????what the answer pleaseeeee 10 points 29 members in math club, treasury has $364 to spend, shirts are $11 caps are $14. How many caps and shirts can he buy to exhaust the funds available? Otto invests $ 600 in an account that pays 7.3 % interest compounded annually. How much is in Otto's account after 3 years Consider Hermia's first words when she enters the scene. How do her comments about the setting relate to the action of the scene? In particular, how might Shakespeare intend a double meaning here for her use of the word "sense"? A woman sold an article for 20.00cedis and made a profit of 25%.Find the cost price of the article. What is the sign of -9. (0/-3) Lighting is the movement of? What is 100 5 4 + 43 A. 69B. 144C. 0.3D. 1.2 From the top of the leaning tower of Pisa, a steel ball is thrown vertically downwards with a speed of 3.00 m/s. if the height of the tower is 200 m, how long will it take for the ball to hit the ground? Ignore air resistance. Suppose that the speeds of cars travelling on California freeways are normally distributed with a mean of miles/hour. The highway patrol's policy is to issue tickets for cars with speeds exceeding miles/hour. The records show that exactly of the speeds exceed this limit. Find the standard deviation of the speeds of cars travelling on California freeways. Carry your intermediate computations to at least four decimal places. Round your answer to at least one decimal place. Express this sense sequence as a polypeptide. Use the three letter abbreviation and separate the amino acids with a dash - e.g. Trp-Thr-Ala. If there is a stop codon - you may add an asterisk to the sequence - e.g. Trp-Thr-Ala-* ATTTTAGCCATGCCCGGGAAAATACGCCGCCCTCCCGGTACACCATTGTTCGGCAAATAAAAATAAAAT polypeptide sequence [answer1] what is the DNA sequence of the 5' UTR? [answer2] what is the RNA sequence of the 3' UTR [answer3]