Vertebrates can be subdivided into five major groups: fishes, amphibians, reptiles, birds, and mammals. Amphibians, reptiles, birds, and mammals are ranked as classes.
what type of food is made during photosynthesis
Answer:
glucose
Explanation:
Plants, unlike animals, can make their own food. They do this using a process called photosynthesis . During photosynthesis, plants produce glucose from simple inorganic molecules - carbon dioxide and water - using light
(bbc)
The sun is a natural resource used by people. Why is the sun considered a renewable resource? *
the sun goes away at night and then comes back in the morning
on cloudy days, the sun cannot be used
solar energy from the sun is limited
the sun is an unlimited source of energy that isn't used up as fast as people use it
Answer:
Because the earth continuously receives solar energy from the sun, it is considered a renewable resource.
Explanation:
How many moles of NaCl are in 200 grams?
Answer:
3.42 moles
Explanation:
Molar mass of NaCl= 58.4 g/mol
Number of moles in 20g of NaCl is
200.0/58.4 = 3.42 moles
During Meiosis, an important event occurs where the chromosomes that you inherited from your mom exchange pieces with the chromosomes you inherited from your dad. This process is called:
a. Genetic Exchange
b. Recombination
c. Synapsis
d. Crossing Over
Answer:
Hi, there your answer is D.Crossing Over
Hope This Helps
PLZ CORRECT ME IF I AM WRONG :)
Explanation:
This is the type of succession that
occurs when all of the usable soil
has been destroyed in an
ecosystem.
A seccession
B primary
C Secondary
C. Secondary Succession
The process of an ecosystem returning to its stable form after a disaster is known as secondary succession.
This happens faster than primary succession because the soil is already formed and nutrients are more available at the beginning of the process.
Hope it helps you! ＼(^ᴥ^)／
Secondary is the type of succession that occurs when all of the usable soil has been destroyed in an ecosystem.
What is a succession?Succession is the process of change and development that occurs in an ecosystem over time. It refers to the gradual replacement of one community of plants and animals with another, as each community modifies the physical and biological environment in which it lives. There are two main types of succession: primary succession and secondary succession.
Primary succession occurs in an ecosystem that has no soil or vegetation, such as on newly formed volcanic islands or in areas where glaciers have retreated. During primary succession, the ecosystem must develop from scratch, with the creation of new soil and the establishment of new plant and animal communities. This process can take a significant amount of time.
Secondary succession occurs when all of the usable soil has been destroyed in an ecosystem. This type of succession can occur after a natural disaster, such as a fire or a flood, or after human activity, such as logging or farming. During secondary succession, the ecosystem must rebuild itself from scratch, with new soil being created and new plant and animal communities establishing themselves. This process can also take a significant amount of time, depending on the severity of the disturbance and the conditions of the ecosystem.
Learn more about succession, here:
https://brainly.com/question/26675203
#SPJ2
If the number of births and deaths in a given time are equal, then the population size will be stable. True or False?
Answer:
True
Explanation:
Because for each death someone is born
It's like 1+1+1-1-1=1
The answer is the same
Which statement correctly compares mass and weight?
A.Both depend on the force of gravity pulling on an object B.The basic unit of both is the kilogram C.Both mass and weight ofan object would be less on the moon than on Earth D.Weight varies with location, but mass does not vary
Answer:
D. Weight varies with location, but mass does not vary
Explanation:
Weight can be defined as the force acting on a body or an object as a result of gravity.
Mathematically, the weight of an object is given by the formula;
[tex] Weight = mg [/tex]
Where;
m is the mass of the object.g is the acceleration due to gravity.Mass can be defined as a measure of the amount of matter an object or a body comprises of. The standard unit of measurement of the mass of an object or a body is kilograms.
Irrespective of the location of an object or a body at a given moment in time, the mass (amount of matter that they're made up of) is constant. This ultimately implies that, whether you're in the moon, space, earth or any other place, your mass remains the same (constant).
Hence, the statement that correctly compares mass and weight is that, weight varies with location, but mass does not vary. This is simply because acceleration due to gravity changes with location i.e its value varies with the planets.
Base your answer to questions 8 and 9 on the diagram below and on your knowledge of
biology
The diagram represents a portion of a starch molecule.
8. The energy in this molecule is stored
1. in the bonds between atoms
2. when the carbon atoms break off
3. in the oxygen found in the molecule
4. when water breaks this molecule apart
9. The building blocks for this molecule are
1. amino acid
bases
2. simple sugars
3. Fats
4. molecular
In a starch molecule, the energy is stored in the bonds between atoms, and the building blocks of this molecule are simple sugars.
Starch is a carbohydrate and a polysaccharide, this means this molecule is composed of dozens of glucose molecules that have formed a chain and it is used by organisms, especially plants to store energy.
In other words, starch is the result of glucose molecules forming a chain, and glucose is considered a simple sugar. Therefore, starch is made up of simple sugars.
On the other hand, the energy in starch can be found in the bonds between atoms. This implies once the bonds between atoms break energy is released, and this energy is used by organisms for multiple activities.
Learn more about molecule in: https://brainly.com/question/19922822
Which of the following describes the products of mitosis?
two unique cells
one cell identical to the parent
cell death
two daughter cells that have identical DNA to the parent
Answer:
The products of mitosis are two diploid cells, whereas the products of meiosis are four haploid cells. -Mitosis and meiosis both begin with duplicated chromosomes. -In mitosis the daughter cells are genetically identical, but in meiosis the daughter cells are genetically varied.
Explanation:
What is flight initiation distance FID
Answer:
Fight initiation distance (FID) is the distance at which an animal will start to move away from an approaching threat such as a trail user.
hope this helps<3
In a photo-tropic experiment, young seedlings in a box were subjected to light from one direction. The seedling continue to grow erect. Which of the following statement is correct
A. Only the tip of the seedling received the light
B. The light was not strong enough
C. The seedlings were rather too young
D. The tip of the seedling may have been covered
E. The box containing the seedling should have been placed on a laboratory bench
Answer: It could be that B, that the light wasn't strong enough
Explanation:
I'm not sure, but the plant didn't grow towards the light, so that's a possible answer I saw
Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first C): ATGCTGCGAAACTTTGGCTGA Provide the 6 DNA codons that would be read following the mutation. Are they the same as the original 6 DNA codons that would have been read
Answer:
Codons after the mutation are not exactly the same as before mutation, because one base was deleted, changing the sequence of codons.
Codons before mutation: ATG TGC GAA ACT TTG GCT
Only the first one (ATG) might coincide with one of the codons before mutation.
Explanation:
Genetic information for the aminoacids assembly during the protein synthesis is stored in short sequences of three nucleotides named codons in the DNI or mRNA. Each of the codons represents one of the 20 amino acids used to build the protein. There are a total of 64 codons. 61 codify amino acids, one of these amino acids is also the start point of protein synthesis, and the left three codons are stopping translation points.
The Sequence before mutation ATGCTGCGAAACTTTGGCTGA
Codons: ATG CTG CGA AAC TTT GGC TGA
The Sequence after mutation ATGTGCGAAACTTTGGCTGA
Codons: ATG TGC GAA ACT TTG GCT
Only the first one (ATG) might coincide with one of the codons before mutation.
John Needham, Louis Pasteur, and other scientists all performed experiments to disprove ______.
a) spontaneous generation
b) evolution
c) Koch's postulates
d) binomial nomenclature
Answer:
A) spontaneous generation
Explanation:
Spontaneous Generation theory stated that living organisms could be spontaneously generated from non-living matter. Francesco Redi conducted an experiment similar to the one Louis Pasteur would do nearly 200 years later. The 17th-century Italian developed a spontaneous generation experiment that showed that maggots do not spontaneously emerge from decaying meat.
MARK THIS ANSWER BRAINLIEST PLEASE ❤️
The theory of spontaneous generation is an experiment that tries to prove the possibilities that living organisms can be produced from non-living origins.
This experiment was first done by Francesco Redi in 1668. However, several scientists such as John Needham, Louis Pasteur, John Tyndall amongst other scientist tried to disprove the theory of spontaneous generation.
The theory was later disproved by Louis Pasteur and John Tyndall in the mid-19th century.
Read more about spontaneous generation at:
https://brainly.com/question/2003717
ALL of the following are applicable only
in the United States EXCEPT
A. Clean Water Act
B. Safe Drinking Water Act
C. Marine Protection, Research, and Sanctuaries Act
D. London Convention on the Prevention of Marine
Pollution
Answer:
the answer is C. Marine protection, research and sanctuaries Act.
The most diverse community would typically found in
Habitat 1
Habitat 2
Habitat 3
Non of the above
I’ll Venmo u 5 dollars if u help me. I have a human made for of pollution and natural form of pollution. I have to pick which one is human and natural
Which of the following is NOT true of fungi?
Select one:
a.
They digest their food outside of the body
b.
They recycle inorganic nutrients to photosynthesizers
c.
Each of the filaments on the body is a mycelium
d.
Fungi cells lack chloroplasts
A forest fire destroys an area. A small population of trees and a large population of birds are both affected. Which type
of limiting factor causes this?
density dependent
density independent
population dependent
population independent
Answer:
B. DENSITY INDEPENDENT
Explanation:
Density independent is a limiting factor. It affect birth and death rates of organisms through abiotic and environmental factors. A forest fire is one of the environmental factors that affects the density of a species in a given location.
please help me with this
Plyometrics can help a person maintain cardiorespiratory fitness true or false
During a storm, heavy rain ___________ a large rock into smaller pieces and then those pieces are __________ downstream from one place to another. *
erodes / weather
deposits / eroded
weathered / eroded
discharges / deposits
Answer:
1) erodes
2)deposits
Explanation:
Describe how the complete oxidation of 1 mole of glucose can generate 32 ATPs. You should include i) products of anaerobic glycolysis with numbers, ii) products of Krebs cycles with numbers, and iii) process of ATP synthesis by electron transport chain via NADH/FADH and H ions
Answer:
Explanation:
1.During glycolysis,four molecules of ATP are formed,and two are expended to cause the initial phosphorylation of glucose to get the process going.This gives a net gain of two molecules of ATP
For every glucose molecule that undergoes cellular respiration, the citric acid cycle is carried out twice; this is because glycolysis (the first stage of aerobic respiration) produces two pyruvate molecules per glucose molecule. During pyruvate oxidation (the second stage of aerobic respiration), each pyruvate molecule is converted into one molecule of acetyl-CoA—the input into the citric acid cycle. Therefore, for every glucose molecule, two acetyl-CoA molecules are produced. Each of the two acetyl-CoA molecules goes once through the citric acid cycle.
The citric acid cycle begins with the fusion of acetyl-CoA and oxaloacetate to form citric acid. For each acetyl-CoA molecule, the products of the citric acid cycle are two carbon dioxide molecules, three NADH molecules, one FADH2 molecule, and one GTP/ATP molecule. Therefore, for every glucose molecule (which generates two acetyl-CoA molecules), the citric acid cycle yields four carbon dioxide molecules, six NADH molecules, two FADH2 molecules, and two GTP/ATP molecules. The citric acid cycle also regenerates oxaloacetate, the molecule that starts the cycle.
While the ATP yield of the citric acid cycle is modest, the generation of coenzymes NADH and FADH2 is critical for ATP production in the final stage of cellular respiration, oxidative phosphorylation. These coenzymes act as electron carriers and donate their electrons to the electron transport chain, ultimately driving the production of most of the ATP produced by cellular respiration.
D)
transgenically reduced
12)
The energy required for a seedling to push up out of the ground comes from
A)
muscle tissue.
B)
photosynthesis.
C)
food stored in the seed.
D
other plants
Answer:
In the seed is the energy required for a seedling to push up out of the ground comes from food stored in the seed.
How does your model support the claim that
the Northern and Southern Hemispheres
have different seasons?
Answer:
Due to presence on opposite side of the globe.
Explanation:
My model support the claim that the Northern and Southern Hemispheres have different seasons due to present on different location on the globe. The seasons in the Northern Hemisphere are different and opposite of those in the Southern Hemisphere. Seasons occur because Earth is tilted on its axis. This tilting causes summer in one location whereas winter in other location. The Earth's tilt causes the Southern Hemisphere to lean towards the Sun during summer season of Southern Hemisphere while on the other hand, it is winter season in the Northern Hemisphere which leans away from the Sun.
Which is NOT a passive transport mechanism across the membrane of a plant cell?
Which is NOT a passive transport mechanism across the membrane of a plant cell?
Facilitated diffusion
Diffusion
Osmosis
Receptor-mediated endocytosis
Answer:
the company has also announced plans
Which is a positive effect of wildfires?
Answer: it lets for room for more buildings to be built
Explanation:
Which process is characterized by the movement of particles from an area of high concentration to an area of low concentration across the plasma membrane without the use of energy?
1) hypertonic transport
2) active transport
3) passive transport
4) dynamic equilibrium
Answer:
3) passive transport
Explanation:
Passive transport is a type of cellular transport that does not require the use of energy to move substances (i.e., ions and molecules) across biological membranes. Passive transport uses concentration gradients to move substances across cell membranes, thereby transporting them from regions of high concentration to regions of low concentration. Passive transport can be divided into 1-osmosis (i.e., movement of solvents), 2-diffusion (i.e., movement of solutes), and 3-facilitated diffusion (i.e., movement of molecules with help of protein channels or carriers), and 4-filtration (i.e., movement of water by using a pressure gradient).
Answer: moves particles from on area of low concentration to an area of high concentration
Explanation: Active transport differs from passive transport because active transport
can only move particles into the cell.
does not require energy to transport particles.
moves particles from an area of low concentration to an area of high concentration.
depends on the random movements of particles to carry them across the membrane.
EDG2023
Fat cells are expandable. How does this structure relate to a fat cell's function?
A) Fat cells store energy for the body to use later, so being
expandable would help with storage.
B) Fat cells burn energy quickly when other food source is available, so being expandable would help with the rapid burn.
C) Fall cells protect organs, so being expandable can help with cushioning.
D) Fat cells do not expand
Answer:
Explanation:
d
How does water help drive the rock cycle?
A. It is abundant on Earth's surface.
B. It is an agent of weathering and erosion.
C. It helps Earth maintain a relatively constant temperature.
D. It maintains a liquid state in a relatively narrow range of temperatures
ap3x
Which of the following could occur as the result of runoff of high nitrogen fertilizers from farmlands near a lake?
O an increase in algae growth resulting in low oxygen levels in the lake
O a decrease in mineral storage reducing carbon levels of the lake
O a decrease in pollution in lower ozone levels in the lake area
O an increase in deforestation reducing animal populations in the lake area
Answer: the first one an increase in aldae
Explanation:
