Eye color is an example of 1. Transcriptional control 2. gene expression 3. translational control 4. gene regulation

Answers

Answer 1
Answer:

Eye color is an example of Gene expression


Related Questions

what are sex hormones?why are they named so? state their function.

Answers

Answer:

Sex hormones or hormones of the reproductive organs are certain cells in the reproductive organs that produce hormones.

The testis produces testosterone,the male sex hormone,and the ovaries produces oestrogen and progesterone, the female sex hormones.

In a sexually mature male,testosterone influences sexual behaviour, and together with FSH,regulates sperm production in the seminiferous tubules of the testes.

Sexually matured females undergo a regular 4-week reproductive or menstrual cycle during which a mature egg is released.This cycle is regulated by oestrogen and progesterone. During pregnancy, progesterone inhibits egg production (ovulation),brings about the development of the placenta and prevents the uterus from contracting....I hope this answers your question... Thank you for the question.

who discovered micro organisms​

Answers

Robert Hooke is the person that discovered Micro organism

Answer:

An English architect, "Robert Hooke" discovered micro organisms in 1665.

Hope this helped!

Have a nice day:)

BRAINLIEST would really help me:)

Proteins in the cell membrane have many functions. Which type of protein would be used for cell recognition and as a receptor? A. Pore proteins B. Endoplasmic proteins C. Glycoproteins D. Integral proteins

Answers

Answer:

C. glycoproteins

Explanation:

Glycoproteins are proteins containing glycans (oligosaccharide carbohydrates) attached to amino acid side chains. These oligosaccharides are attached to the amino acid chain by a posttranslational modification referred to as glycosylation, a modification generally found in extracellular regions. Glycosylation refers to the chemical reaction in which a glycosyl donor (i.e., the carbohydrate) is attached to a functional group in the protein. The glycosylation sites play distinct functional roles for both cell interactions and cell recognition. Moreover, glycosylation sites are also essential for substrate recognition by an enzyme. For example, secreted cytokines are glycosylated, which is required for their binding to receptors.

Why is environmental science important?

Answers

Explanation:

it is where we live and share resources with order species

I hope this was helpful

Imagine an invertebrate that lives in an estuary where salinity varies cyclically with the tides. If this individual is able to adjust the salt concentration of its body fluids, its salt concentration will have:____. a. a cyclic variation depending upon when the animal drinks. b. regular variations that range from large to small. c. slight fluctuations that are kept within a narrow range. d. a cyclic variation opposite that of the surrounding water.

Answers

Answer: Option C.

slight fluctuations that are kept within a narrow range.

Explanation:

An invertebrate that lives in an estuary where salinity varies cyclically with the tides. If this individual is able to adjust the salt concentration of its body fluids, its salt concentration will have slight fluctuations that are kept within a narrow range so has to maintain homeostasis and prevent the cells of the the invertebrate from not shrinking which can be due to the salt solution (Hypertonic).

Estuary is an area of water or shorelines where river meet the ocean. It normal do have concentration of salts. Organisms that live in estuaries must be able to adapt to their dynamic environments, wich is due to variations in water chemistry includes salinity, as well as physical changes like the rise and fall of tides.

name 3 physiological processes of cell membrane?{3mks} plz help me guys

Answers

Answer:

the cell membrane is an extremely pliable structure composed primarily of back -to- back phospholipids (a "bilayer")

a pupil performed an experiment in a school lab to show the action of a digestive enzyme on a food substance

a) Name and enzyme suitable for such an experiment
b) Name a food substance on which the enzyme that you have named will act
c) Describe any preparation of the food required before the experiment is performed. If no preparation is required state why?
d) give the temperature at which the enzyme-food mix should be maintained for the experiment to work
e) how much time is needed for digestion of food in this experiment?
f) describe a test to confirm that digestion has occurred ​

Answers

I prefer d as the correct answer!!!

a student hypothesized that pillar coral eat and digest zooxanthellae. which of these observations would cause the student to change this hypothesis

Answers

Answer:

the zooxanthellae in a pillar coral's body are alive

which best describes bacterium?

Answers

Answer:

Bacteria (singular: bacterium) are classified as prokaryotes, which are single-celled organisms with a simple internal structure that lacks a nucleus, and contains DNA that either floats freely in a twisted, thread-like mass called the nucleoid, or in separate, circular pieces called plasmids. Hope this helps :))

Explanation:

Answer:

Bacteria are classified as prokaryotes, which are single-celled organisms with a simple internal structure that lacks a nucleus, and contains DNA that either floats freely in a twisted, thread-like mass called the nucleoid, or in separate, circular pieces called plasmids.

Explanation:

Which is most likely a source of air pollution? littering CFCs oil spill runoff

Answers

Answer: CFCs

Explanation: The other options aren’t as relevant to air pollution.

Answer:

cfcs

Explanation:

The image shows a food web in an Arctic ecosystem. Rising temperatures in the Arctic Ocean can lead to large die-offs of phytoplankton, which are autotrophs. What would most likely happen in an Arctic ecosystem if the phytoplankton population decreased?

Answers

Answer:

as the population of phytoplankton decreases, the amount of food for zooplancktons decreases

A gamete is best described as what?
A. The protective outer layer of an egg cell.
B. An enzyme in a sperm used to digest the egg cell's membrane.
C. A haploid cell produced for reproduction.
D. A diploid cell produced for reproduction.

Answers

Answer:

C. A haploid cell produced for reproduction.

Explanation:

The term "gamete" refers to reproductive cells such as sperm and ova. Sperm and ova are both haploid cells that unite to form diploid cells.

What do nitrifying bacteria do?

Answers

Answer: Nitrifying bacteria such as Nitrosomonas play an important role in providing nitrogen to plants and limiting carbon dioxide fixation. They are found widely distributed in soil or water, where there are large amounts of ammonia, such as lakes or streams into which treated and untreated sewage is pumped.

Explanation:

Answer:

They change Nitrogen to Nitrite and ammonia. Which helps plants to use Nitrogen even though it's in another form.

Hope this helps ;) ❤❤❤

Why was the Nationalist Party more popular in China’s cities than in the countryside? Wealthy people who supported the party were concentrated in cities. People in the countryside were less active in politics than people in the city. Poor city dwellers hoped the Nationalist Party would bring economic change. The Nationalist Party threatened to end crop trade with Western nations.

Answers

Answer:

Wealthy people who supported the party were concentrated in cities.

Explanation:

Answer:

The answer is A on edge

Explanation:

Consider the following chromosomes and if they are affected by hemophilia. X - unaffected X chromosome, x = X affected by hemophilia, and Y = Y chromosome. If an Xx female and XY male have children, what fraction of their offspring will have an affected chromosome, and what fraction is likely to be affected by the hemophilia? (1 point) A. 1/4 and 1/2 B. 1/2 and 1/4 C. 1/2 and 1/3 D. 1/4 and 1/4 Ive been stuck on this for a while now, can someone please assist?

Answers

Answer:

B. 1/2 and 1/4

Explanation:

Hemophilia is a disease inherited in humans. It is only carried on the X chromosome, hence, it is said to be X-linked. In this question;

X - unaffected X chromosome

x = X chromosome affected by hemophilia,

Y = Y chromosome

Hence, in a cross between a Xx female (carrier) and a XY male (unaffected), the following chromosomes will be present in the gametes produced by each parent:

Xx- X and x gametes

XY- X and Y gametes

Using these gametes in a punnet square (see attached image), offsprings with genotypes: XX, Xx, XY and xY are produced.

XX (1) - unaffected normal female

Xx (1) - unaffected carrier female

XY (1) - unaffected normal male

xY (1) - affected male

Based on the questions;

- 2 out of the possible 4 children have the affected chromosomes i.e. both xY son and Xx daughter have the x chromosome. Hence, the fraction is 1/2

- 1 out of the 4 possible children is affected by hemophilia, which is the xY son. Hence, the fraction is 1/4.

Answer:

1/2 and 1/4

Explanation:

Took the test

what are the major groups of animals and how to they differ

Answers

There are many living things in the world. To keep them simple and easier to remember, the scientists had identify many groups of animals. The six main groups are: invertebrates, mammals, birds, amphibians, reptiles and fish.

Can podocyte cells in the Bowmann capsule attach to any other basement membrane other than the glomerular basement membrane? That is, it can itself have a separate layer of base membrane?​

Answers

Answer:

"Podocytes are cells in the Bowman's capsule in the kidneys that wrap around capillaries of the glomerulus. Podocyte cells make up the epithelial lining of Bowman's capsule, the third layer through which filtration of blood takes place.[1] The Bowman's capsule filters the blood, retaining large molecules such as proteins while smaller molecules such as water, salts, and sugars are filtered as the first step in the formation of urine. Although various viscera have epithelial layers, the name visceral epithelial cells usually refers specifically to podocytes, which are specialized epithelial cells that reside in the visceral layer of the capsule. "

Explanation:

hope this helps

Please I need help with this

Answers

TAAGCCGATAAATGCTAACGGTA

Consider the cladogram. A cladogram is shown. Roundworms have the derived characteristics of true tissues, bilateral symmetry, and a pseudocoelom. Which group of organisms has the derived characteristics of true tissues, bilateral symmetry, and a pseudocoelom? sponges roundworms annelids chordates

Answers

Answer:

The correct answer is - roundworms.

Explanation:

The answer is already mention in the question, however, the detailed answer is as follows:

The characteristics that are given in the question are true tissues, bilateral symmetry, and a pseudocoelom. Worms or helminths are known as primitive form of organization of the Bilaterians. All three group of worms or helmints have a basic bilateral symmetry.

These organisms inaugurated various characteristic that are found and carried by other animals such as  true tissues, bilateral symmetry, and a pseudocoelom.

Thus, the correct answer is - roundworms.

Answer:

its b

Explanation:

What results if a broken chromosomal fragment becomes reattached as an extra segment to a sister or non-sister chromatid? A Duplication B Inversion C Polyploidy D Nondisjunction

Answers

Answer:

The correct answer is option A "Duplication".

Explanation:

Chromosomal duplication is defined as a type of rearrangement of genetic material at which extra copies of a DNA fragment are created. In this case if a broken chromosomal fragment becomes reattached, this fragment will represent an extra copy, and therefore the resultant genetic material is considered a chromosomal duplication.

While performing an experiment, it is important to:
a. change the control setup
b. test many different variables at the same time
c. reach a conclusion
d. record observations and measurements

Answers

Answer:

D

Explanation:

While performing an experiment, it is important to record observations and measurements, as in Option d. Option d is correct regarding the facts of the experiments, while the others are wrong.

What is an experiment?

The experiment is carried out to observe the hypothesis, and in this process, a control set-up is taken whose value or result is already known, and the variables are taken and compared with the control. The controls set should never change in the experiment because the variables are tested with reference to them, and the measurements and observations of the experiment should be taken into consideration to prove the hypothesis. All the variables should not be tested at once because if this is done, it would introduce error into the experiment, and not all the experiments are done to get the conclusion.

Hence, while performing an experiment, it is important to record observations and measurements, as in Option d.

Learn more about the experiment here.

https://brainly.com/question/11256472

#SPJ2

why it is necessary to water the plant for experiment​

Answers

Answer:

To activate the process of germination.

Explanation:

So the plants can get the whole photosynthesis step because it need sunlight and water to continue to grow.

Which ecosystem service would suffer from the opening of a mineral mine along a small mountain range?

A. Cultural
B. Provisioning
C. Regulating
D. Supporting

Answers

Answer:

D. Supporting

Explanation:

Ecosystem services include provisioning, regulating, culture and supporting services.

Opening of a mineral mine along a small mountain range will affect the supporting services of ecosystem because supporting services deals with soil formation, provision of habitat and nutrition cycle.

Opening of mineral mine will destroy the tosoil, landscape, forests and wildlife of mountain area which affect the supporting services such as habitat and soil formation.

Hence, the correct answer is "D. supporting".

what type of cash crops have been genetically modified..... please help!!!!!

Answers

Answer:

Most food modifications have primarily focused on cash crops in high demand by farmers such as soybean, corn, canola, and cotton. Genetically modified crops have been engineered for resistance to pathogens and herbicides and for better nutrient profiles.

Explanation:

Ultra-high-temperature sterilization effectively reduces microbes that cause spoilage. removes only mesophilic microbes. reduces microbes that cause disease. removes all microbes that cause diseases or spoilage. reduces microbes that cause disease or spoilage.

Answers

Answer:

kills all microbes that cause disease or spoilage.

Explanation:

There are different methods of sterilization, such as ultraviolet radiation, autoclave mechanisms, etc.

The sterilization mechanisms eliminate the microorganisms completely, thus generating sterile surfaces.

These mechanisms are used with surgical instruments, the operating room environment.

The autoclave method is the most widely used today due to its economical price, its ease of use and its practicality.

Sterilization methods must be strictly controlled with pilot or test microbiological cultures to be able to corroborate that these mechanisms function correctly, since otherwise they could trigger strong pathologies due to cross contamination.

what action is a reflex action

Answers

Answer:

A reflex action is an involuntary , quick  response to a stimulus, which minimises any damage to the body from potentially harmful conditions, such as touching something hot.

Explanation:

Which of the following is not a negative consequence of upward urban growth?
a pollution
b creation of a "heat island"
C. increased use of surrounding land
d. waste management issues
Please select the best answer from the choices provided
A
OOOO

Answers

Answer: I believe its C

Explanation:

Answer:

C. increased use of surrounding land

Explanation:

Edge2021

The hypothalamic hormone that triggers the secretion of FSH and LH from the anterior pituitary is

Answers

Answer:

Hypothalamic-Pituitary-Gonadal Axis

GnRH produced by the hypothalamus stimulates the production of both LH and FSH. FSH functions by stimulating ovarian follicular development in females and regulating spermatogenesis in males. LH induces ovulation and corpus luteum formation in the ovaries.

plz give brainlist

hope this helped

Atmospheric nitrogen can be fixed by nitrogen-fixing bacteria. Arrange the following forms of nitrogen from the atmospheric N stage to the final form that enters the roots. 1. Ammonia 2. Nitrogen gas 3. Ammonium ion 4. Nitrite 5. Nitrate

Answers

Answer:the answer is ammonia

Explanation:the nitrogen fixing bacteria fix the nitrogen as ammonia

____is associated with deamination of protein​

Answers

Answer:

Deamination is the removal of an amino group from a molecule

Deamination is associated with deamination of protein​

Answer:

in humans , deamination  takes place primarily in the liver, it can also occur in the kidney. if there's excess protein intake , deamination is used to break down proteins with amino acids for energy

Other Questions
Write a dialogue between two students regarding the ongoing online classes across the globe. Solve.-7(2z + 4) = 21 You are out camping in a remote area. The next day, you plan to hike the mountain trail and return to camp before dusk. Your friends suggest that after hiking, you might want to enjoy a warm shower. They suggest that before you head out in the morning, you should suspend a strong, black cloth bag full of about 5 gallons of water, so that it sits in sunshine all day. When you return, the water should be warm, and you can enjoy a luxury because of good planning. It works and you are delighted and refreshed! The process that you used to get a warm shower illustrates Help please!!! Thank you Given the following angles, what ray is the common side of ZCFD and ZDFE?DE0Ray FDRay FERay FC A ball is thrown upward from a height of 432 feet above the ground, with an initial velocity of 96 feet per second. From physics it is known that the velocity at time t is v (t )equals 96 minus 32 t feet per second. a) Find s(t), the function giving the height of the ball at time t. b) How long will the ball take to reach the ground? c) How high will the ball go? How to do this question plz answer my question plz List the metals Mg, Cu, Au, Na and Al in the decreasing order of their reactivity with air. Which type style raps the text within the area that has been selected for it?A.point styleB.long linear styleC.line style D.paragraph style How did the end of the Vietnam War mark a difference in US foreign policy? A. The US had never lost a war before, making war a less favorable option B. The US required an attack on US soil first before beginning a war C. The US would not get involved in any foreign wars after it D. The US would begin new wars in Southeast Asia to prove its strength i think the answer. . .is the second one please correct me if i'm wrong A grocery store recently sold a bag of peanuts for $0.76 and a bag of Pikachu's for $3.68 at the end of the day 50 bags of peanuts and Pikachu's were sold for a total of 128 point 52 how many bags of each were sold Gina, Sam, and Robby all rented movies from the same video store. They each rented some dramas, comedies, and documentaries. Gina rented 11 movies total. Sam rented twice as many dramas, three times as many comedies, and twice as many documentaries as Gina. He rented 27 movies total. If Robby rented 19 movies total with the same number of dramas, twice as many comedies, and twice as many documentaries as Gina, how many movies of each type did Gina rent? The central problem in product-oriented layout planning is? light of wavelength 550 nm is incident on a diffraction grating that is 1 cm wide and has 1000 slits. What is the dispersion of the m = 2 line? Finn likes it when her days are unpredictable and filled with problems to solve. She thrives on solving puzzles and then testing out the different solutions in search of the "right fit." How would you describe Finns personality? An aqueous solution of potassium bromide, KBr, contains 4.34 grams of potassium bromide and 17.4 grams of water. The percentage by mass of potassium bromide in the solution is 20 %. solve for x: 5x+3+8x-4=90 round your answer to the nearest hundredth. Find angle A=? DPMO stands for:______ a) Defects Per Million Opportunity b) Defectives Per Million Opportunity c) Data Per Million Opportunity d) all of the above e) none of the above