Find m Of the function

Find M Of The Function

Answers

Answer 1

Answer:

m=1

Step-by-step explanation:

slope formula is y=mx-b

whenever a variable is by itself, the coefficient is always 1


Related Questions

A two-by-four piece of wood is 1 1/2 inches wide. If placed side-by-side, how many boards are needed to make a width of 48 inches?

Answers

Answer:

35 left is 2 i think

Step-by-step explanation:

Sabeena’s pen measures 144 millimeters long. Her pencil measures 18 centimeters long. How many centimeters longer is Sabeena’s pencil than her pen?

Enter the correct answer in the box.

Answers

Answer:

3.6 cm or 36mm

Step-by-step explanation:

So we know that there are 10 millimetres in a centimetre. So we can convert the 18cm into millimetres to make it easy to subtract

18cm*10=180mm

now take the pencil length subtracted by the length of the pen.

180mm-144mm=36mm  

now if you want the answer in cm, convert it by dividing the answer by 10

36/10=3.6cm

Hope This Helps :)

Answer:3.6 cm  

Have a great day!

Rewrite 3 4/11 as an improper fraction
A.23/4
B.37/11
C.18/11
D,23/11

Answers

Answer:

B 37/11

Step-by-step explanation:

Brainliest please

Answer:

B. 37/11

Step-by-step explanation:

Multiply 3 by 11 and get 33

and add 4

37

improper fraction: 37/11

Does Y= -2/3x + 3 & Y=2/3x + 2 have unlimited solutions?

Answers

Answer:

x = 3/4

y = 2.5

Step-by-step explanation:

No there is just one.

Equate the ys

-2/3 x + 3 = 2/3 x + 2                        Add 2/3 x to both sides

3 = 2/3 x + 2/3x + 2                          Combine

3 = 4/3 x + 2                                     Subtract 2

3-2 = 4/3 x                                        Multiply by 3

1 * 3 = 4x                                          Divide by 4

3/4 = x

====================

y = 2/3 x + 2

y = 2/3 * 3/4 + 2

y = 6/12 + 2

y = 1/2 + 2

y = 2 1/2

y = 2.5

is this proportional relationship? please help!!

Answers

Answer:

yes, the slope is the same throughout the table

Step-by-step explanation:

Answer:

Yes, the graph shown is a proportional relationship.

Step-by-step explanation:

If you divide the distance (6) by the time (1) you get the same thing (6). Repeat for all the terms in the graphs. Since 6/1 is 6, 12/2 is 6, 18/3 is 6 and 24/4 is 6, The relationship is proportional.

#12, what is this answer ?

Answers

Answer:

joan chris martin sara

Step-by-step explanation:

Seven less than three times a number is two.

Answers

Answer:

let x be the number

seven less than three times a number ==> 3x - 7

Step-by-step explanation:

I am solely here to brag!
I am officially a college student and only 14!
Next semester I will on top of my high school classes be taking college courses.
And by 11th grade be officially done with high school!

Answers

Answer:

That's wonderful!

Step-by-step explanation:

I'm really proud of you! I'm 14 (almost 15), and taking sophomore classes right now, and a foreign language. I absolutely regret not taking a second math class this year (Algebra II).

Who wants a lot of points
then answer this


C=
5
9
(F−32)

The equation above shows how temperature F, measured in degrees Fahrenheit, relates to a temperature C, measured in degrees Celsius. Based on the equation, which of the following must be true?

A temperature increase of 1 degree Fahrenheit is equivalent to a temperature increase of
5
9
degree Celsius.
A temperature increase of 1 degree Celsius is equivalent to a temperature increase of 1.8 degrees Fahrenheit.
A temperature increase of
5
9
degree Fahrenheit is equivalent to a temperature increase of 1 degree Celsius.
A) I only
B) II only
C) III only
D) I and II only

Answers

It should be b that should be it

(9×9)×{-5}÷2=.....please help​

Answers

Answer:

405/2

202 remainder 1

Step-by-step explanation:

pliz mark brainliest

Answer:

81×(-5)÷2

-202.5

-405 down 2 , -202 1down2

Step-by-step explanation:

did I got wrong? ?

Olivia filled 6 baskets of strawberries. Later she combined the fruit evenly into 3 larger boxes. if all 3 boxes sold for $42, how much money did each box of strawberries cost?

Answers

Answer:

21

Step-by-step explanation:

becuase that's the answer lol

i genuinely don't understand . please help me asap

Answers

Answer:

48.17

Step-by-step explanation:

Umm.. i don't really have time to explain but

A^2+B^2=C^2

36^2+32^2=48.17

if one person has 3/4 0f your laundry what does kyle have?

Answers

Answer:

kyle has got 1/4 of your laundry xD

Step-by-step explanation:

laundry=1

3/4=1 person

1-3/4=1/4

so 1/4=kyle

Answer:

Kyle has 1/4 of the laundry.

Step-by-step explanation:

If one person has 3/4 that means there is 1/4 left.

 So, Kyle has 1/4 left to do.

find the slope of the line​

Answers

Answer:

Up 5, 2 to the right (5/2)

Step-by-step explanation:

I just counted the units of the Cartesian Plane

if 4 pounds of potatoes is 3 dollars, how many dollars is 1 pound of potatoes?

Answers

Answer: $1.33

Step-by-step explanation:

4 divided by 3

Joe surveyed 128 students at his school. In the survey, he asked students what type of sibling they had: brother, sister, both, or neither. His data is in the Venn diagram below.

Answers

Answer: 128 - 48 equals 80. 80 - 35 equals 45. That means the answer is 45.

Step-by-step explanation:

pls answer quick !!!

Answers

Answer:

A = The greatest common factor would be 9.

B: 45+63= 9*(5+7)

Step-by-step explanation:

Answer:

b is 45+63=9(5+7)

Step-by-step explanation:

Once you know the GCF, you just need to find what the GCF (9 in this case), times what will get you 45 and 63. So we already know that 9 will be on the outside of the parentheses since it's what we're multiplying by. 9 times 5 is 45, so for the first number in the parentheses you'll put 5, and for the second, 9 times 7 is 63, so the second number in the parentheses is 7. You can check by solving it. 9(5+7). Use the distributive property and first you will do 9 times 5, which is 45, then 9 times 7 which is 63, so you'll get 45+63, which is correct.

Marlene expects her gross income to be $54,000 this year, and she expects her required deductions to amount to $15,000. Her employer covers 90% of the cost of a $4800-per-year health insurance plan and 80% of the cost of a $900-per-year life insurance plan, with the remainder of the cost coming out of Marlene's pay, and Marlene also expects to contribute 8% of her gross income this year to her 401(k) plan. She wants to calculate how much she will receive for each of her bimonthly paychecks.

Answers

Answer:

Marlene will receive $1,417.50 for each of her bimonthly paychecks.

Step-by-step explanation:

This can be calculated using the following 3 steps:

Step 1: Calculation of annual deductions to bear by Marlene

Required deductions = $15,000

Contribution to cost of health insurance plan per-year = $4800 * 10% = $480

Contribution to cost of life insurance plan per-year = $900 * 20% = $180

Contribution to this year's 401(k) plan = $54,000 * 8% = $4,320

Step 2: Calculation of annual paychecks

Annual paychecks = Gross income - Required deductions - Contribution to cost of health insurance plan per-year - Contribution to cost of life insurance plan per-year - Contribution to this year's 401(k) plan = $54,000 - $15,000 - $480 - $180 - $4,320 = $34,020

Step 3: Calculation of bimonthly paychecks

Bimonthly paychecks = Annual paychecks / 24 = $34,020 / 24 = $1,417.50

Therefore, Marlene will receive $1,417.50 for each of her bimonthly paychecks.

The club sold shirts and capes to raise money for new stage equipment. The club sold each shirt for $20.00. The club made profit of $4.00 for each shirt. Sold. Part A: The drama club sold a total of $480.00 worth of shirts. How much profit did the club make from the shirt sale?

Answers

Answer:

The club made a profit of $96 from the shirt sale.

Step-by-step explanation:

First, you have to find the number of shirts sold by dividing the total amount sold by the price per shirt:

480/20=24

Now, that you know the number of shirts that were sold, you can multiply the profit per shirt for the number of shirts sold:

4*24=96

According to this, the answer is that the club made a profit of $96 from the shirt sale.

which is another way to write 42 + 63?

Answers

Answer:

B

Step-by-step explanation:

The sum of 42 + 63 is equal to 105.

B is the only answer that matches the sum of 42 and 63.

7 * 15 = 105

:3))

what is the answer to X - 8 < -2

Answers

Answer:

X>6

Step-by-step explanation:

X-8<-2

X<-2+8

X>6

because the sign changed from negative to positive, the inequality has to be flipped

Billy Bob is filling his bathtub with water. At one minute, there are 5
gallons, at two minutes there are 8 gallons, and at 3 minutes there are
11 gallons of water in the tub.
If this pattern continues, how many gallons of water will be in the tub
at 7 minutes?

Answers

Answer:

There will be 23 gallons

Answer:

23 gallons

Step-by-step explanation:

the bathtub is filling by 3 more gallons every minute, 7-4=3, 4*3=12, 11+12=23

N(x) will give you an output for any number you use as an input except which of the following?

Answers

n(x) will give output for any number except 0.

define equation

An equation consists of two sides, the left-hand side and the right-hand side, which are separated by an equals sign (=). The left-hand side and the right-hand side each contain one or more variables, which are quantities that can vary or be assigned different values.

Given

n(x)=2/x

From the given option, 3 and5  will satisfy the equation.

n(x)=2/3 for the value of x=3

n(x)=2/5 for the value of  x=5

For the value of x=0

O will not satisfy.

n(x)=2/0=not defined

Hence, n(x) will give output for any number except 0.

To know more about variables, visit:

https://brainly.com/question/17344045

#SPJ1

2 - (7/8 - 3/4) what is the answer

Answers

Answer: hjhgxxhjhg

Step-by-step explanation:

help me plz and i will give bairnlest frfrf and 30 points

Answers

Answer:

5,469

Step-by-step explanation:

Brainliest for the correct answer 20 points!!!

Answers

Answer:

y = -3/2x + 3

Step-by-step explanation:

Answer:

y= 3 - 2x

Step-by-step explanation:

Which equation is not linear

A. -4x + 2y =7
B. x/4 =y
C. X=-5
D. 2/x + 3/y

[ that's / not a division it's a fraction bar]

Answers

The answer to this question is C.X=-5

Solve for A
Exact (no rounding, no calculator needed)

0 = A^2 + 13A + 36

Answers

Answer:

-4 or -9

Step-by-step explanation:

-a^2-13a-36=0

(-a-4)(a+9)=0

-a-4=0

a+9=0

a= -4, -9

Ifa line segment has a length of 12 units and after a dilation the image
length is 4 units, what was the scale factor?
A. 1/3
B. 3
C. 8

Answers

Answer: Choice A) 1/3

================================================

Work Shown:

x = preimage length = 12

y = image length = 4

z = scale factor

z = y/x

z = 4/12

z = (1*4)/(3*4)

z = 1/3

The scale factor is 1/3.

This means the image is 1/3 of the length of the preimage.

Help!!!!!!!!!! Thanks

Answers

Answer:

[tex]m=-1[/tex]

General Formulas and Concepts:

Pre-Algebra

Order of Operations: BPEMDAS

Algebra I

Slope Formula (Rate of Change): [tex]m=\frac{y_2-y_1}{x_2-x_1}[/tex]

Step-by-step explanation:

Step 1: Define

Find points from graph.

Point (-4, 0)

Point (-3, -1)

Step 2: Find slope m

Substitute:                     [tex]m=\frac{-1-0}{-3+4}[/tex]Subtract/Add:                [tex]m=\frac{-1}{1}[/tex]Divide:                           [tex]m=-1[/tex]
Other Questions
For another question, Nancy needs her to mark the numbers 1 1/3 and -1 1/3 on the number line. How many spaces does she need between 1 and 2, and between -1 and -2, so that she can mark 1 1/3 and -1 1/3? Fill in the blank with the Spanish word that best completes the following sentence.Cuando necesito dinero, hablo con _________. 5) In a urea manufacturing plan, all employees work a basic week of 40 hours. Ay overtime worked during weekdays is paid for at time-and-a-quarter. Overtime worked on Saturday is paid for at time-and-a-half, whilst on Sunday it is paid for at double time. If the basic rate is $14.60 per hour and a man worked 15 hours overtime during weekdays, 6 hours overtime PLEASE HELP ME!! I WILL MARK BRAINLIEST!! : How did the events in the reading establish Portugal as a major trading centre? What were some of the goods that the Portuguese traded? Were these different from those that the Italian merchants offered? What is inflation A. An increase in the supply of currency that reduces the currencys value B. A demand for more goods that can be met by production C. An increase in unemployment due to a serious recession D.an excess of goods that results in lower prices Multiple ChoiceWhich method adds an element at the beginning of a deque?appendleftO insertleftO popleftaddleft Which element is probably most like Carbon? and why Examine the map of major North American cities. A map titled Major Cities in North America with labels A, B, C, and D. Canada, the United states, and Mexico are labeled. A is near Washington and Canada. B is near the Pennsylvania and New York. C is in southern California. D is in Mexico. Which city is located at C? Vancouver Los Angeles Guadalajara Washington, DC GIVING BRAINLIEST!!!What were the major issues that prisoners faced in Andersonville prison? Select all that apply. (2 points)A. Water was scarce and polluted.B. Food supplies were inadequate so prisoners starved.C. Prisoners rebelled and staged an uprising.D Prison overcrowding forced prisoners to be freed early. What is the product of 417.2 x 0.64? what do you mean by community based medical profession simplify by combining like terms: 3 1/9p + 5 - 1/3p How would adding the catalyst nitrogen monoxide (NO) affect this reaction?2SO2(g) + O2(g) 2SO3(g)A) NO increases the rate at which SO3 molecules are formed.B) NO reacts with SO3 to produce more SO2 molecules.C) NO decreases collisions between the SO2 and O2 molecules.D) NO increases the concentration of the SO2 and O2 molecules.E) NO increases the activation energy of the SO2 and O2 molecules. thanks guys i only got one question wrong i cant find my answer. You should really give your people the answer they are looking fo instead of giving sujestions. Write the slope-intercept equation for the graph. Energy that is stored is called... Transcribe the following DNA strand into mRNA and translate that strand into a polypeptidechain, identifying the codons, anticodons, and amino acid sequence.DNA: CGATACAATGGACCCGGTATGCGATATCC write a letter to your friend describing him/her about your country nepalGuys plz help me with this question write a letter about nepal. If u guys help me with this question i will make you brainliest and give 25 points. But its so urgent so plz do it fast.