Find the area of the shape below. 5yd 7yd

Find The Area Of The Shape Below. 5yd 7yd

Answers

Answer 1

Answer:

45.99 yd²

Step-by-step explanation:

The square is 5 yd × 7 yd

35 yd²

The circle = 2 × pi × radius

2 × 3.14 × 3.5

21.99115 rounds to 21.98 yd²

Since it is have a circle,

21.98 yd² ÷ 2

10.99 yd²

35 yd² + 10.99 yd²

45.99 yd²

Answer 2
45.99 yd ^^ good luck

Related Questions

Pls Help! Put a proper answer! If you put a link I will report you!
When clearing the fractions in the equation below, what is the Least Common Denominator?

Answers

Step-by-step explanation:

X - ⅙X = - ½ - ⅓ ==> ⅚X = - ⅚ ==> X = -1

write a mathematical equation and calculate the area of the irregular polygon

Answers

3)5/6)=x 36-508-7392

ANSWER THE QUESTION FOR BRAINLIEST

Answers

Non linear means not a straight line so answer C or the third answer.

Answer:

not a straight line

Step-by-step explanation:

Linear has the word "line" in it. A linear relation has a graph shaped like a straight line.

Nonlinear means "not like a straight line".

Answer: not a straight line

find the slope of each line​

Answers

Answer:

(1,1) and (2,-4)

Step-by-step explanation:

i supposed each line is 1,2,3,4,5 because it is not given the graph numbers but I hope it could help

Mrs. Smith is shopping for a toy chest to go
in her kids' playroom. She looks at the options
shown.


How much floor space will toy chest A take up?

Answers

Answer: 20ft

Step-by-step explanation:

floor space is only worried about the area of the base, so A would be 4*5 or 20

Answer:

20

Step-by-step explanation:

Which of the following is closest to the mean absolute deviation of this
data set: 2.1, 3.5, 4.6, 5.8, 3.9, 4.2, 2.8?

A. 0.89
B. 1.6
C. 3.84
D. 3.9

Answers

Answer:

0.89

Step-by-step explanation:

Trust


The functions f and g are defined as follows.
g(x) = -2x3-5
f(x) = - 4x + 2
Find f (6) and g(-3)
Simplify your answers as much as possible.

Answers

Answer:

f(6) = -22, and g(-3) = 49

Step-by-step explanation:

f(x) = -4x + 2

f(6) = -4(6) + 2

f(6) = -24 + 2

f(6) = -22

I assume the 3 in g(x) = -2x3 -5 is cubed

g(-3) = -2(-3)^3 - 5

g(-3) = -2(-27) - 5

g(-3) = 54 - 5

g(-3) = 49

Which graph represents a direct variation?

Answers

I don't know all of them I guess since I can't see the graphs

Answer:

The graph of the direct variation equation is a straight line through the origin.

Step-by-step explanation:

What is an equation of the line that passes through the point (-5,-2) and is
parallel to the line x - y = 5?

Answers

Answer:

[tex]y=x+3[/tex]

Step-by-step explanation:

What we need to know

Linear equations are typically organized in slope-intercept form: [tex]y=mx+b[/tex] where m is the slope of the line and b is the y-intercept (the value of y when the line crosses the y-axis)Parallel lines have the same slope

1) Rewrite the equation x - y = 5 into slope-intercept form and identify the slope

[tex]x - y = 5[/tex]

Subtract both sides by x

[tex]x - y -x= -x+5\\-y= -x+5[/tex]

Divide both sides by -1

[tex]y= x-5[/tex]

Now, we can tell clearly that the slope (m) of this line is 1. Therefore, a line parallel to this would also have a slope of 1.

Plugging 1 as m into [tex]y=mx+b[/tex], we get:

[tex]y=x+b[/tex]

2) Find the y-intercept (b) of the line parallel to [tex]y= x-5[/tex] and find the final equation

[tex]y=x+b[/tex]

Plug in the given point (-5,-2)

[tex]-2=-5+b[/tex]

Add 5 to both sides

[tex]-2+5=-5+b+5\\3=b[/tex]

Therefore, the y-intercept of this line is 3. Now, plugging this back into our original equation, we get:

[tex]y=x+b\\y=x+3[/tex]

I hope this helps!

Raymond bought wrapping paper that cost
$0.04 per square inch. How much did it cost to
wrap this box.

Answers

Answer: $46.08

Step-by-step explanation:

Find the surface Area of the box

the bases are 12*12= 144 times 2 bases 144*2= 288

The area of each side is 12*18=216 times 4 sides 216*4=864

add the totals together to find the total surface area 288+864=1152

total surface area is 1152 inches. Multiply by the cost per square inch

1152*.04= 46.08

Hi I need ur help! (And this is the other one if you saw my last question)

Answers

Answer:

Hi gimmie brainly

thanks

Please I beg of you answer this question please answer this correctly no links no trolls pleaseeee

Answers

Answer:

Step-by-step explanation:

pi r^2 for area

pi 35^2

pi1225= about 3848.45

2pi r for circumference

2pi35

pi70= about 219.9

How do you write 5.09 104 in standard form?

Answers

509,000
Hope that helped :)

The diameter of a cake is 7.8 inches. What is the area of the cake?

Answers

A = πr^2
The radius is half of the diameter.
r = 7.8 / 2
r = 3.9

A = π(3.9)^2
A ≈ 47.78

Answer:

A = 12.25 sq inches

Step-by-step explanation:

A = (7.8/2)²π

A = 3.9²π

A = 12.25 sq inches

Apply the distributive property to create an equivalent expression. 6 ( a + 2 b + 3 c ) =

Answers

Answer: 6

Step-by-step explanation: a + 2b + 3 c = a + 2b + 3c

at a football game, every person is either a fan of the home team or of the visiting team. omar observes that the ratio of fans of the home team to fans of the visiting team is 7:2. omar states that the total number of fans at the game must be an odd number because 7 + 2 = 9 and 9 is an odd number.

Determine a number of fans of the home team and a number of fans of the visiting team that show omar statement is false.

the first question is, enter a number of fans of the home team that would show Omar's statement is false.

the second question, enter a number of fans of the visiting team that would show omar statement is false.



pls I need help!!!!!!​

Answers

14 fans for the home team and 4 for the away will still hold the ratio and prove Omar’s statement false.

Will give brainliest for correct answer

Answers

Answer:

A function is a rule that assigns to each input exactly one output.

Step-by-step explanation:

If you have more than one of the same inputs for multiple outputs, it would create a vertical line at somepoint on your line.

Answer:

The correct answer is "a rule that assigns to each input exactly one output".

Step-by-step explanation:

In mathematics, a function is a binary relation between two sets that associates to each element of the first set exactly one element of the second set. Typical examples are functions from integers to integers, or from real numbers to real numbers.

A worldwide organization of academics claims that the mean IQ score of its members is 118, with a standard deviation of 17. A randomly selected group of 40 members of this organization is tested, and the results reveal that the mean IQ score in this sample is 115.8. If the organization's claim is correct, what is the probability of having a sample mean of 115.8 or less for a random sample of this size

Answers

Answer:

0.2061 = 20.61% probability of having a sample mean of 115.8 or less for a random sample of this size

Step-by-step explanation:

To solve this question, we need to understand the normal probability distribution and the central limit theorem.

Normal Probability Distribution:

Problems of normal distributions can be solved using the z-score formula.

In a set with mean [tex]\mu[/tex] and standard deviation [tex]\sigma[/tex], the z-score of a measure X is given by:

[tex]Z = \frac{X - \mu}{\sigma}[/tex]

The Z-score measures how many standard deviations the measure is from the mean. After finding the Z-score, we look at the z-score table and find the p-value associated with this z-score. This p-value is the probability that the value of the measure is smaller than X, that is, the percentile of X. Subtracting 1 by the p-value, we get the probability that the value of the measure is greater than X.

Central Limit Theorem

The Central Limit Theorem estabilishes that, for a normally distributed random variable X, with mean [tex]\mu[/tex] and standard deviation [tex]\sigma[/tex], the sampling distribution of the sample means with size n can be approximated to a normal distribution with mean [tex]\mu[/tex] and standard deviation [tex]s = \frac{\sigma}{\sqrt{n}}[/tex].

For a skewed variable, the Central Limit Theorem can also be applied, as long as n is at least 30.

A worldwide organization of academics claims that the mean IQ score of its members is 118, with a standard deviation of 17.

This means that [tex]\mu = 118, \sigma = 17[/tex]

A randomly selected group of 40 members

This means that [tex]n = 40, s = \frac{17}{\sqrt{40}} = 2.6879[/tex]

What is the probability of having a sample mean of 115.8 or less for a random sample of this size?

This is the pvalue of Z when X = 115.8.

[tex]Z = \frac{X - \mu}{\sigma}[/tex]

By the Central Limit Theorem

[tex]Z = \frac{X - \mu}{s}[/tex]

[tex]Z = \frac{115.8 - 118}{2.6879}[/tex]

[tex]Z = -0.82[/tex]

[tex]Z = -0.82[/tex] has a pvalue of 0.2061

0.2061 = 20.61% probability of having a sample mean of 115.8 or less for a random sample of this size

Factor the binomial b^2 - 9

Answers

Answer:

(b-3)(b+3)

Step-by-step explanation:

b^2+3b-3b-9

Answer: (b-3)(b+3)
Explanation: Sum-product pattern, then find the common factor(s), rewrite into factored form : )

Put the lowest number on the left 2 0 -3 -4

Answers

Answer:

-4, -3, 0, 2

Step-by-step explanation:

Answer:

-4,-3,0,2 :p ...........

Fast Auto Service provides oil and lube service for cars. It is known that the mean time taken for oil and lube service at this garage is 15 minutes per car and the standard deviation is 2.4 minutes. The management wants to promote the business by guaranteeing a maximum waiting time for its customers. If a customer's car is not serviced within that period, the customer will receive a 50% discount on the charges. The company wants to limit this discount to at most 8% of the customers. What should the maximum guaranteed waiting time be

Answers

Answer:

The maximum guaranteed waiting time should be of 18.37 minutes.

Step-by-step explanation:

Normal Probability Distribution:

Problems of normal distributions can be solved using the z-score formula.

In a set with mean [tex]\mu[/tex] and standard deviation [tex]\sigma[/tex], the z-score of a measure X is given by:

[tex]Z = \frac{X - \mu}{\sigma}[/tex]

The Z-score measures how many standard deviations the measure is from the mean. After finding the Z-score, we look at the z-score table and find the p-value associated with this z-score. This p-value is the probability that the value of the measure is smaller than X, that is, the percentile of X. Subtracting 1 by the p-value, we get the probability that the value of the measure is greater than X.

It is known that the mean time taken for oil and lube service at this garage is 15 minutes per car and the standard deviation is 2.4 minutes.

This means that [tex]\mu = 15, \sigma = 2.4[/tex]

The company wants to limit this discount to at most 8% of the customers. What should the maximum guaranteed waiting time be?

The 100 - 8 = 92th percentile, which is X when Z has a pvalue of 0.92. So X when Z = 1.405.

[tex]Z = \frac{X - \mu}{\sigma}[/tex]

[tex]1.405 = \frac{X - 15}{2.4}[/tex]

[tex]X - 15 = 1.405*2.4[/tex]

[tex]X = 18.37[/tex]

The maximum guaranteed waiting time should be of 18.37 minutes.

What is 74 in standard form? O A. 11 OB. 28 Oc. C. 2, 401 O O D. 16,384​

Answers

Answer:

oc2

Step-by-step explanation:

because

3. A savings account has a 3% interest rate. (a) Complete the ratio table shown. Show your work. Deposit ($) 100 50 300 Interest ($) 3 12 6 36 (b) How much more interest would you have if you deposited $200 than if you deposited $150? Show your work.

Answers

Answer:

Wait what

Step-by-step explanation:

Find the equation of the line shown. Enter yoir answwr in slope intercept form​

Answers

Answer:

y = x

Step-by-step explanation:

The equation for slope is y = mx +b. If you look at the line you see that it passes through the origin, this is your y-intercept, 0. If you look at two points at the line and use the rise over run method, you get the slope to be 1. If you substituent these values into the equation you get, y = x.

Hope this helps!

-Luna

Other Questions
the rhythmical pattern of the stressed syllables in a poema. proseb. parodyc. symbold. meter Es importante que Uds. ____ (entender) la clase.Ella quiere que Marta ____ (lavar) la ropa.Quiero que tu ____ (comer) algo nutritivo.Ojal que no _____ (llover) esta tarde.Mi madre quiere que yo ____ (comer) frutas.Despus quiere que nosotros _____ (jugar).Mi padre quiere que tu ____ (volver) pronto.Ojal que todos Uds. ____ (ganar) el premio.Es importante que tu ____ (cepillarse) los dientesNo es buena idea que Uds. ____ (llenarse) el estmago con comida. What is sin(77)? plz help Need help, please... Which limiting factor is this adaptation a response to 2. Which ethic do you think is most important for a journalist to have? Why? Write the relationship between cells, tissue and organs in human body.(plzzzzz answer correctly) At an auto repair shop. 3.5 hours of labour costs $311.50. What is the labourcharge for a 5 hour job? 4. How are the main narrator and Simon Wheeler different? Give as many details aspossible. What fossil helped support Wegener's hypothesis of continental drift?A. GondwanalandB. KannemeyeridC. MesosaurusD. Glossopteris 2What does Don Pepe's lesson to Nayeli in paragraph 13 reveal about theirrelationship?A. He was protective of her and did not want to worry her about life's difficulties.B. He thought she would be able to understand complicated ideas.C. He found her annoying and wanted to limit their conversations.D. He was interested in unusual trivia and wanted to share it with her. what is the mRNA in TACCGGATGCCAGATCAAATC? Layla is going to invest $5,200 and leave it in an account for 15 years. Assuming the interest is compounded monthly, what interest rate, to the nearest tenth of a percent, would be required in order for Layla to end up with $13,800? Most Americans consume a varied diet. They eat foods that are both plant- and animal-based. Which words are clues to the meaning of the word consume? A. are both B. eat foods C. animal-based D. Most Americans why is it important to save energy in our daily lives Red and white blood cells are produced inside the __________ of bones. This is an interaction between the skeletal, circulatory, and immune systems.A. MarrowB. Spongy BoneC. Compact BoneD. Liver This Question: 1 pt20 of 20This QuthThe pH of a fruit juice is 2.9. Find the hydronium ion concentration, [H30 * ), of the juice. Use the formula pH = -log[H30*]The hydronium ion concentration [H30 + ] is approximately moles per liter.(Use scientific notation. Use the multiplication symbol in the math palette as needed. Round to the nearest tenth as needed.) A worldwide organization of academics claims that the mean IQ score of its members is 118, with a standard deviation of 17. A randomly selected group of 40 members of this organization is tested, and the results reveal that the mean IQ score in this sample is 115.8. If the organization's claim is correct, what is the probability of having a sample mean of 115.8 or less for a random sample of this size When riding your bike on a main road you should always follow the rules of the _________.roadbikers guidewalkerstown they are riding in Can someone please help me on this plz I beg u :(