g A ________ intensifies mid-latitude cyclones by creating a region of divergence above the surface low pressure center. Group of answer choices jet streak barotropic system longwave triple point

Answers

Answer 1

Answer:

A jet streak intensifies mid-latitude cyclones by creating a region of divergence above the surface low pressure center.

Answer 2

The jet streak increase in mid-latitude cyclones by the creating a region of divergence above the surface's low-pressure center.

What is a jet steak?

The jet streak is caused by the large lower level temperature gradient and is more intense in the cool season. They have temperature variations and can differ from the polar regions. They have a pressure of 300 MB.

Hence they are called as fast-moving air currents. these can be seen across the united states. May be related to the heat waves or floods.

Find out more information about the cyclones.

brainly.com/question/1222576


Related Questions

Which statements refer to weather and which refer to climate.

a. The baseball game was rained out today.
b. January is Omaha's coldest month.
c. North Africa is a desert.
d. The high this afternoon was 25°C.
e. Last evening a tornado ripped through central Oklahoma.
f. I am moving to southern Arizona because it is warm and sunny.
g. Thursday's low of -20°C is the coldest temperature ever recorded for that city.
h. It is partly cloudy.

Answers

Answer:

a. weather

b. climate

c. climate

d. weather

e. weather

f. climate AND weather

g. climate AND weather

h. weather

Arrange the events in the order that they’re likely to occur leading up to the formation of a solar system.
The temperature increases.
The nebula shrinks.
The nebula spins.
A cloud of dust and
gas forms.
The nebula flattens into
a disk.
Nuclear fusion takes place.












Answers

Answer:

1. A cloud of dust and gas forms

2. the nebula flattens into a disk

3. the nebula shrinks

4. the nebula spins

5. nuclear fusion takes place

6. the temperature increases

Answer:The temperature increases.

The nebula shrinks.

The nebula spins.

A cloud of dust and

gas forms.

The nebula flattens into

a disk.

Nuclear fusion takes place.

Explanation:i got it correct on plato

Which situations describe increasing atmospheric stability (choose all that apply): Group of answer choices daytime solar heating of the surface increases surface temperatures cold air from land moves over a warm lake rising surface temperatures on a calm, sunny summer day environmental lapse rate increasing with time a North wind brings in cold air from Canada, lowering surface temperatures Surface air cools while air aloft warms

Answers

Answer:

daytime solar heating of the surface increases surface temperatures.

Explanation:

Atmospheric stability is the condition where the air is generally considered to be stable than earlier due to the certain changes that take place over the period of time which are associated with the weather and climatic variability. As the colder air mass is denser than the warmer and lighter air mass thus reverse in the condition leads to instability.

If you are flying over a mountain and see sedimentary layers making an outline in the shape of an overturned cereal bowl, the feature would be called a(n)

Answers

Answer:

Dome

Explanation:

A dome is known as a structure with a curved shape like the shape of a half sphere and is also not perfectly round.

When flying over a mountain and see sedimentary layers making an outline in the shape of an overturned cereal bowl. The overturned cereal bowl seen assumes the shape of a dome in the explanation given above . This validates the outline being that of a dome.

At 12 Z (7 am EST) on 13 March 1993, observations of the surface analysis map indicate a _______ air mass lying to the west and northwest of the surface low (well behind the cold front). Group of answer choices mT cP mP Next

Answers

Answer:

At 12 Z (7 am EST) on 13 March 1993, observations of the surface analysis map indicate a cold air mass lying to the west and northwest of the surface low (well behind the cold front).

Explanation:

On that day, the storm known as "storm of the century" occurred, where a hot front caused the creation of several tornadoes and a cyclone originating in the Gulf of Mexico, with high-speed winds that extended as far as Florida.

Map of the United States shows a highlighted area encompassing much of the southwestern United States, particularly along the Rio Grande and Rockies.

Which weather event would most likely take place in the ecosystem highlighted on this map?

A. Blizzard, because the ecosystem is very cold and wet
B. Drought, because the ecosystem is very dry
C. Hurricane, because the ecosystem is near a coastline
D. Thunderstorm, because the ecosystem is humid and wet

Answers

The Answer is B.

This is because the Rockies has a very dry climate that doesn’t receive much rainfall. So, the chances of a drought are the highest.
The answer is B that’s the correct answer

Which is the most widely practiced religion in North America?
O Islam
Judaism
Hinduism
Christianity

Answers

Answer:

Christianity

Explanation:

Explain what a subduction zone is and how it relates to volcanic activity and earthquakes.

Answers

Answer:

At a subduction zone, the oceanic crust usually sinks into the mantle beneath lighter continental crust. Called the "Ring of Fire," these subduction zones are responsible for the world's biggest earthquakes, the most terrible tsunamis, and some of the worst volcanic eruptions.

Explanation:

Answer:

i have the exact answer for this one

make sure you click the image to see it, or else it looks kinda dull

Explanation:

Based on the population density maps above, what can be inferred about Britain’s migration patterns? A. The population of Britain was greater in 1701 than in 1911. B. Britain was more densely populated in 1911 than in 1701. C. Fewer people lived in urban areas in 1911 than in 1701. D. The northern part of the island was more densely populated than the southern part in 1701.

Answers

Answer:

i think its A sorry if its wrong

Explanation:

What is topographic Map? ​

Answers

Answer:

A Topographic maps is used to represent the Earths features.

Explanation:

Topographic maps are a detailed record of a land area, giving geographic positions and elevations for both natural and man made features. They show the shape of the land the mountains, valleys, and plains by means of brown contour lines (above sea level)

Answer:

Topographic maps: Tools for planning

Explanation:

Topographic maps are a detailed record of a land area, giving geographic positions and elevations for both natural and man-made features. They show the shape of the land the mountains, valleys, and plains by means of brown contour lines (lines of equal elevation above sea level).

Hope this helped you

MA has no unit of measurement.Why?​

Answers

Answer:

Mechanical advantage (also written as MA in formulas) is the factor by which a machine multiplies force. ... There is no unit for mechanical advantages since the unit for both input and output forces cancel out.

The transformation of snow into glacial ice in Antarctica takes ________ than (as) in midlatitude alpine glaciers because ________. Group of answer choices

Answers

Answer:

The answer is "longer; and  In polar regions, fewer snowstorms are per year, and in Antarctica, less melting and refreezing tend to occur".

Explanation:

The Antarctic consists of several glaciers, land ice, and icebergs, in which There have been no trees or shrubbery, the Moss and algae are the only plants, that survive in a cold place.  

The conversion of polar ice throughout Antarctica for moderate ice caps, which takes much longer time than a snowstorm is reduced per year, that's why it is the less cooling, and refrigeration is observed in Antarctica.

The equator and the prime medirían break up the earth into which hemispheres??

Answers

It is the Western Hemisphere

Answer:

Northern, Southern, Eastern, and Western. The Equator, or line of 0 degrees latitude, divides the Earth into the Northern and Southern hemispheres.

Explanation:

A ____ tax is a tax levied on the removal of natural resources (especially oil and gas) from the earth.

Answers

Answer:

A severance tax.

Explanation:

If you were to examine the longitudinal profile of a typical river, you would probably find that the gradient is ________.

Answers

Answer:

steepest near the headwaters.

Explanation:

Stream Gradient is the slope-drop over distance. Stream gradient can be defined as a drop of stream in vertical line and falling over a horizontal distance.

The steam gradient, if we examine the longitudinal profile of a typical water, will be steepest near the headwaters. The stream gradient is steepest near the headwaters whereas gentle at the mouth. After the stream reaches at the mouth it gets discharged into another water body.

So, the correct answer is that the stream gradient is steepest near the headwaters.

The longitudinal profile of a typical river, we will find that the stream gradient is steepest near the headwaters.

What is stream gradient?

Stream Gradient is a slope drop by distance. Stream Gradient can be defined as the drop of stream in a vertical line and falling over a horizontal distance.

Steam gradient, if we examine the longitudinal profile of normal water, would be very dangerous near the river. The gradient of the stream rises sharply near the headwaters while it is soft in the mouth.

After the stream reaches the mouth it flows into another water source.

Thus, the correct answer is that the stream gradient is steepest near the headwaters.

To learn more about stream gradient, refer:

https://brainly.com/question/1243042

The discontinuity separating the crust from the mantle is named as: A.Mohorovicic B.Conrad C.Reppetty D.Gutemberg

Answers

Answer:

A.mohorovic

Explanation:

The Mohorovičić discontinuity (/moʊhəˈroʊvɪtʃɪtʃ/ MOH-hə-ROH-vitch-itch, Croatian: [moxorôʋiːtʃitɕ]),[1] usually referred to as the Moho discontinuity or the Moho, is the boundary between the Earth's crust and the mantle. It is defined by the distinct change in velocity of seismological waves as they pass through changing densities of rock.[2]

The Moho lies almost entirely within the lithosphere.[3] Only beneath mid-ocean ridges does it define the lithosphere–asthenosphere boundary. The Mohorovičić discontinuity is 5 to 10 kilometres (3–6 mi) below the ocean floor, and 20 to 90 kilometres (10–60 mi) beneath typical continental crusts, with an average of 35 kilometres (22 mi).

Named after the pioneering Croatian seismologist Andrija Mohorovičić, the Moho separates both the oceanic crust and continental crust from underlying mantle. The Mohorovičić discontinuity was first identified in 1909 by Mohorovičić, when he observed that seismograms from shallow-focus earthquakes had two sets of P-waves and S-waves, one that followed a direct path near the Earth's surface and the other refracted by a high-velocity medium.[4]

5. How were Earth's core and mantle formed?

Answers

Answer:

God created the earth Genesis chapters 1 - 2

Which is one factor that will affect the type of cloud that will form? -altitude. -wind direction. - color of clouds. - size of pellets

Answers

An altitude affects the formation of cloud because the base of the cloud forms at an altitude where the rising air cools and condensation starts.

Cloud formation

Generally, the temperature, wind and other conditions are what decides where a cloud forms and what type of cloud it will be.

Other factors that influences a cloud formation includes:

topographyhumidity etc

Hence, an altitude affects the type of cloud to form because the base of the cloud forms at the altitude at which the rising air cools and condensation starts.

Therefore, the Option A is correct.

Read more about cloud formation

brainly.com/question/1242352

Answer: A/1: Altitude

Explanation: Got it right :) Good luck everyone!!

As a wave approaches the shoreline and enters shallower water, energy and water move forward causing the water to rise and cascade down from the wave crest as a breaker. These waves are called

Answers

Waves of translation.

A climate classification based on the geographic determinants of climate, such as latitude or elevation, is an example of a(n)'

Answers

Answer:

Genetic classification.

Explanation:

The genetic classification of climate is based on determinants of climate such as, location with respect to wind and pressure belts, latitudinal control of temperature, effects of mountains.

Genetic classification also relies on information about climatic elements like solar radiation, air masses, and pressure systems.

This classification is qualitative and climate is designated in a subjective manner with no rigorous scientific research done.

If a mineral has a parent to daughter ratio of 1:3 (one parent atom for every three daughter atoms), how many half-lives have passed since the mineral formed?

a. 0
b. 1
c. 2
d. 3
e. 4

Answers

Answer:

c. 2

Explanation:

Given that

Parent to daughter ratio = 1:3

Based on the above information, after considering the 1 half-life of radioactive isotope there is one-half of the real radioactive atoms of the parent left also the equivalent number of daughter atoms produced

Therefore after one half, the ratio between parent and daughter atom is 1:1

Now after the second half, half of the left parent atom would be transformed into the daughter cells

This remains a quarter of parent atom and 3 quarter of daughter atoms

So, the ratio of 1:3 would be shown after 2 half-lives

the sum total of a beliefs and behaviors that a group of people share can be called a

Answers

Answer:

culture

Explanation:

What part of the map shows the amount of reduction required to place an area on a chart, piece of paper, or computer screen?

a. symbolization frame
b. projection box
c. coordinate frame
d. key
e. scale

Answers

Answer:

Scale

Explanation:

The scale shows how much the map has been reduced to be put on the surface.

Hope this helped!

Discuss five
five of component of
a map​

Answers

Answer:

Title, a legend, a grid and a compass

Explanation:

The five components of a maps are a Title, a Legend, a Grid and a compass rose to indicate direction.

The granite dome in Twain Harte was damaged by the growth of ______________ joints, likely due to ________________.

Answers

Answer:

The granite dome in Twain Harte was damaged by the growth of exfoliation joints, likely due to thermal expansion.

Answer the following questions about divergent boundaries, such as the Mid-Atlantic Ridge, and their associated lavas:

a. Divergent boundaries are characterized by outpourings of what type of lava: andesitic, basaltic lava, or rhyolitic?
b. What is the source of these lavas?
c. What causes the source rocks to melt?

Answers

Answer:

a) divergent boundaries are the plates move away from each other. the type of lava is basaltic

b) magma

c) convection current cause the rocks to melt

A scientist determines that "Crystal Volcano" is 5,000 years old. What can that scientist assume about the ages of three other nearby volcanoes

Answers

Answer:

The answer to the question is as follows.

Explanation:

Two major decisions can be taken by examining volcanic stones.

Because the volcanoes were formed by subsidence, they would probably be around the same age. When a hot spot has produced the volcanic activity, the age groups of all the other volcanoes depend on the situation of the Crystal Volcano in the chain.

Define and differentiate between a food chain and food web with appropriate examples. ​

Answers

Answer:

A food chain only just follow one path as animal find food.

A food web only connected by the plant and animal.

Explanation:

Food chain is that chronological process that show energy of the organism to the other,that energy flow the specific path.

Food chain is the single way to the producers and consumers, animal food travels different around level.

Food chain begins the producer and that eaten by the primary consumer,food chain as the start with a green plant as the producer .

food chain very important the survival of the species,food chain is used in ecological modeling food chain complex network of animals.

Food web is natural inter section representation of ecological community,food web is consumer resource system.

Food web is also limited representation of ecosystem species same predators in a food web.

food web is a complex relation,patterns in the structure of real food web networks,food webs using a network theory.

Food web are the feeding connections in an the ecological community, food web is the collection of network and cycle.

What major geographical advantage does agriculture in the Coastal South have over most other regions of North America

Answers

Answer:

The region is largely frost-free so many frost intolerant crops can be grown.

Explanation:

The Coastal South in North America consists of cities like Florida, Texas, and North Carolina. This region is known for the exceptional agriculture that occurs there. The nature of their soil is not the cause of this, rather it has a lot more to do with their climatic conditions which range from the time of the last frost in spring to the beginning of the next frost in fall. So, this allows for about nine months of intensive agriculture.

Frost is ice which is mostly seen on the surface of the soil. It is quite difficult for many plants to survive the harsh condition imposed by frost. So the lengthy number of days and months without frost in the Coastal South gives it a great advantage over compared to many other regions in North America.

modern humans first appeared about __ years ago

Answers

Seven million




Hope i helped

Answer:

200,000 years

Explanation:

Pretty sure that was the answer on a-p-e-x

Other Questions
please help !!!!! please note that two images are there................ i am urgently needs this question On a plane trip, baggage over 40 pounds ischarged at the rate per pound of 1% of the one-way fare. The charge for a bag weighing 52pounds on a trip where the one-way fare is $98is:HELP PLEASEE!! QUICK!! When the hydraulic conductivity Ks = 10 mm/hr; effective matrix potential Ns = 20 mm, and rainfall intensity I = 30 mm/hr , determine the amount of runoff generated when the runoff rate reaches 15 mm/hr?( 2.7 mm or 0.21 mm or 18 mm or 0.67 mm) PLS HELP ASAP Solve the inequality and enter your solution as an inequality in the box below 8>4-x>6 difference between photosynthesis and respiration In a survey of adults in a certain country conducted during a period of economic uncertainty, % thought that wages paid to workers in industry were too low. The margin of error was percentage points with % confidence. For parts (a) through (d) below, which represent a reasonable interpretation of the survey results? For those that are not reasonable, explain the flaw. how many are 2 raised to 2 ??? Choose the PCR primer pair that will amplify the breakpoint of a deletion of the segment of DNA between lines 1and 2. 5' TCGATTCCGGAAAGCTTAGTTTCCCGGGACGTATTGCCAACCTAGGTAAGCGCCGAATATCCATGGGCACC 3'3' AGCTAAGGCCTTTCGAATCAAAGGGCCCTGCATAACGGTTGGATCCATTCGCGGCATTATAGGTACCCGTGG 5'a. 5- AGCTAAGGCCTTTCGA and 5'-CCACGGGTACCTATAA b. 5'- TCGATTCCGGAAAGCT and 5'-ACGTCCCGGGAAACTA c. 5- TCGATTCCGGAAAGCT and 5'-CCACGGGTACCTATAA d. 5'- TCGATTCCGGAAAGCT and 5'- GGTGCCCATGGATATT e. 5' - GGTGCCCATGGATATT and 5' ACCTAGGTAAGCGCCG This rectangular patio is tiled using 50 cm by 50 cm square tiles. How many tiles are used? Imagine that you are the supply chain manager for the Magic Widget company and you need to measure your supply chain performance. The chart shows the financial variables that you will need to perform your task. Financial Variables Total Assets (in $ billions) 15.1 Cost of Goods Sold (in $ billions) 14.3 Inventory: Raw Material Inventory (in $ billions) 0.76 Work-in-progress Inventory (in $ billions) 0.12 Finished Goods Inventory (in $ billions) 0.82 Compute the percentage of assets committed to inventory and inventory turnover. What is the quotient of 35,423 15? The plateau phase of population growth is best described as: A. The population stops growing because they moved into the plateau environment at this stage. B. The population pauses in its growth after a natural disaster before growing again. C. The population moves onto a large, raised, flat area called a plateau for protection from predator. D. The population stops growing because the environment has reached its carrying capacity. The Coriolis effect Choose one: A. causes north-flowing currents in the northern hemisphere to curve to the west. B. causes the same direction of deflection in the northern and southern hemispheres. C. is a deflection of wind or water flowing over the Earth's surface. D. is a phenomenon created by the movement of ocean currents. Light passes through a single slit. If the width of the slit is reduced, what happens to the width of the central bright fringe Our Senate has finally emerged from weeks of debate with a decided version of the Missouri Compromise. Among its list of provisions, all lands acquired in the Louisiana Purchase that are north of the southern border of Missouri, with the exception of Arkansas, will now d. Write the symbol for the nucleus that completes each nuclear equation. (1 point each) URGENT PLS HELP ASAP! THANK YOU :) What is the x-value of point A? I need some help plsssssssssssss Which of the following is a characteristic of outer planets?O Close to the sunFew moonsHave ringsRocky surfaces