George Washington Carver was particularly interested in the products of what foods?
O Peanuts, sweet potatoes, soy
Peanuts, tobacco, soy
Peanuts, potatoes, corn
Soy, potatoes, sweet potatoes

Answers

Answer 1

Answer:

A - peanuts, sweet potatoes, and soy

Explanation:

Answer 2

Answer:

I looked it up and got peanuts, pecans, sweet potatoes, and soybeans...

Explanation:


Related Questions

What is and example of an molecule
Muscle tissue
Protein
Stomach
Unicellular organism

Answers

An example of an molecule is Protein

In which experimental set up shown would you expect the Elodia plant inside a test tube to produce the least amount of oxygen

Answers

Answer:

Due to less concentration of carbondioxide gas.

Explanation:

Elodia plant inside a test tube produces the least amount of oxygen due to limited carbondioxide gas that is necessary for photosynthesis process. If a test tube has less amount of carbondioxide gas which is a reactant in photosynthesis so in the end the Elodia plant generates less amount of glucose as well as oxygen while on the other hand, if there is more carbondioxide gas is available to Elodia plant, more oxygen as well as glucose is produced.

Please help me on this question

Answers

the first one goes with pollutes groundwater , the second one goes with harms aquatic creatures & the last one goes with destroys animals habitats .

A stimulus is anything that causes a reaction or response. What is an example of an outside stimulus and an inside stimulus?

Answers

Answer:Stimulus: any change in an organism's environment that causes the organism to react. It is a fancy way of saying “cause”. Example: An animal is cold so it moves into the sun.

Explanation:

Answer:

hi

Explanation:

any change in an organism's environment that causes the organism to react. It is a fancy way of saying “cause”. Example: An animal is cold so it moves into the sun.

giving brainiest
Scientists find fossils of a wide variety of dinosaur species throughout Mesozoic rocks, which date from approximately 250 million to 65 million years ago. Above the Mesozoic rocks lie Cenozoic rocks, which date from approximately 65 million years ago to the present day. No dinosaur fossils exist in the overlying Cenozoic rocks.


What is the most likely explanation for the lack of dinosaur fossils in Cenozoic rocks?

A. The dinosaurs' biological diversity increased in the Cenozoic Era.

B. Dinosaurs adapted in the Cenozoic Era so that their bodies could no longer be preserved as fossils.

C. There was a mass extinction of dinosaur species at the end of the Mesozoic Era.

D. There was a mass extinction of dinosaur species at the end of the Cenozoic Era.

Answers

Answer:

C

there awasw a mass extinction of dinosaur species at the end of the Mesozoic.

Explanation:

C

Have A Great One!

Answer:

it D

Explanation:

Select the intended meaning of the idiom in the following sentence.
The President's announcement made Washington tremble.
O The people in the government grew anxious.
O The earth shook while the President spoke.

Answers

The people were anxious

Mistakes are sometimes made in duplicating or transmitting genetic information. These mistakes are called

Answers

Answer:

Mutation

Explanation:

Mutation is any alteration or change in the genetic sequence of a gene caused by mutagens (substances) or mistakes during replication of genetic sequences.

A mutation occurs in the gene from time to time, although, the cell has protocols in place to put them under control if they occur. However, when DNA or a gene is being copied and transferred to offsprings, there is bound for mistakes called MUTATION to occur.

What are chromosomes? How are they different between prokaryotes and eukaryotes?

Answers

Answer: A chromosome is a long DNA molecule with part or all of the genetic material of an organism. The primary distinction between these two types of organisms is that eukaryotic cells have a membrane-bound nucleus and prokaryotic cells do not

Explanation:

Chromosomes are long thread of DNA molecule. Prokaryotes have one chromosomes while eukaryotes have many.

Chromosome:

It is a long thread of DNA molecule as a part of genetic material of all living organisms.

In prokaryotes, DNA is not very much compacted.Only one chromosome is usually scene in prokaryotes.

In Eukaryotes, Chromosome are very compacted and form an special structure.Multiple chromosomes are found in Eukaryotes.

   

Therefore, chromosomes are long thread of DNA molecule. Prokaryotes have one chromosomes while eukaryotes have many.

To know more about Chromosomes,

https://brainly.com/question/296477

5. The lion researchers in the film have studied 20% of the park and identified 41 lions. (Show your
work/justify your answer for each section.)
a. The entire Gorongosa park is 4,000 km². Approximately how large (in km) is the portion of
the park that has been studied?
ASAP PLSS

Answers

Answer:

800 km²

Explanation:

If the researchers have studied 20% of the 4000 km² park, to find out how much of the park in km they have studied, all you have to do is find 20% of 4000.

4000 x .20 = 800

800 km² is your answer.

If the area of the entire Gorongosa park is 4,000 km². Among which, 20% of the park is already studied, it means 800 [tex]km^2[/tex].

What do you mean by the researcher?

A researcher may be defined as a kind of person who significantly carries out academic or scientific research in order to find some unrevealed data and information.

According to the question,

The total area of Gorongosa park = Gorongosa park is 4,000 km²

The area which is already studied = 20%.

Now, you have to find the area that is already studied in km. So, you have to calculate the 20% of 4,000 km².

The area which is already studied = 4000 × .20 = 800 [tex]km^2[/tex].

Therefore, if the area of the entire Gorongosa park is 4,000 km². Among which, 20% of the park is already studied, it means 800 [tex]km^2[/tex].

To learn more about Researchers, refer to the link:

https://brainly.com/question/28136063

#SPJ2

from his monohybrid crosses, Mendel developed his first law

Answers

Answer:

Im confused but if your asking for Medel's first law it would be states that for the pair of alleles an individual has of some gene (or at some genetic locus), one is a copy of a randomly chosen one in the father of the individual, and the other if a copy of a randomly chosen one in the mother, and that a randomly chosen one will be copied

Explanation:

The health department is responsible to make sure there are written directions for critical control point procedures.
True
False

Answers

Answer:

I think it's true...

Explanation:

Answer:

True

Explanation:

edge2021

What is the definition of "earth overshoot day?"

Answers

Answer: Earth Overshoot Day is the calculated illustrative calendar date on which humanity's resource consumption for the year exceeds Earth’s capacity to regenerate those resources that year. The term "overshoot" represents the level by which human population overshoots the sustainable amount of resources on Earth.

What he saiddhdhshshshshdhdjdjdjdjdjd

Can someone pleeaseeee helpppp!! I’ll mark the brainliest

Answers

Answer:

i think its C im not sure but normally in my opinion that would be correct

Answer:

natural selection: black moths had a higher chance of survival since they were more camouflaged from the pollution

Explanation:

FIND THE INDEPENDENT & DEPENDENT VARIABLE!

- the amount of iron in blood depends on the amount of red meat a person eats.

Answers

Answer:

The answer is:

Independent: red meat eaten by a person

Dependent: iron in the blood

Explanation:

A dependent variable has to depend on something else, so in order for a dependent variable to exist or happen, there has to be the independent variable. The independent variable is something that does not need anything else to happen for it to take place. It s independent. Such as, a mother cannot have a child without sperm. The mother have a child is dependent, where the sperm is independent.

The Earth is ________________of years old

Answers

Answer:

the earth is 4.543 billion years old

I Will Give BRIANIEST
A scientist tests the water in a local pond and finds that it has a pH of 7.9.

What is true about the water sample?

Choose 1 answer:


(Choice A)
A
It is basic.


(Choice B)
B
It is acidic.


(Choice C)
C
It is neutral.


(Choice D)
D
It is both basic and acidic.

Answers

Answer:

it is Basic brooooooo. No B NOT C AND NOT D. oNly A

The answer is A. The ph of regular water is about 7.0 or so. so since it's 7.9 it means it's basic. You're welcome :)

1. What is an operon?

a. The binding site for a repressor PRO.

b. Any group of genes responsible for the metabolism of lactose in a prokaryotes or eukaryotes.

c. A cluster of genes under the control of a promoter.

d. A regulatory gene.

Answers

Answer:

The answer is D

Explanation:

Answer: c! I think, hope this helped

___is a process that tells cells to stop dividing if they touch each other.

Answers

Answer:

Contact inhibition

Other Questions
The table represents a function.What is f(-2)?0 -3-6-2f(x)314-2O-1O 1O 3 The 12 students in the Environmental Club represent 20% of the students in the seventh grade. How many students are in the seventh grade? In 1965 King and his wife, Coretta Scott King, led demonstrators on ahistoric 54-mile march that took five days, from where to where? HELPPPPPPPPPPPPPPP!!!!!!!!!!! BRAINLIEST IS ON THE LINE!!!!!!!!!!!!!!!!!Write a summary for Macbeth Act 1 Scene 2. What is the answer to question 7, NH4C2H3O2 what country has not experienced balkanization? PLS HELP FAST, IM FAILING LOLWhat is true about life under slavery?A. Slave owners discouraged slaves from adopting elements of whitecultureB. Slave owners did not pay slaves for their work,c. Enslaved African Americans had equal rights to those of whitepeopleD. Slaves had a great deal of freedom other than choosing where towork. Match the expression with an equivalent expression 6( n + 4 ) = 3(2(8-2x4)+25divided by 5 )-(2(8 divided by 4x2)-7(7-2x3) can you please help me:) Please help 4 questions for 10 points!!!------------------------------------------------------------1) Which expression is equivalent to 4(23)?4(20+3)4(2+3)4(2+13)4(20+30)..................................................................................................2. Which expressions are equivalent to 4(42)?Select each correct answer.4(20+22)4(40+2)4(4+20)4(4+2).......................................................................................................3.Which expression shows how 645 can be rewritten using the distributive property?640+6206+205640+6564+65...............................................................................4.Tori uses the greatest common factor and the distributive property to rewrite this sum:24 + 84What expression does Tori write?2(24+42)12(2+7)24(1+4)4(6+21).....................................................................my last one got deleted.... paid rent of Rs.25000 by cheque. make journal entry write the code for RNA from this DNA STRAND :AAAAAATTTTTTCCCGGGGTTTATATATC RIP grandsonhow does earths crust change earths surface y32c-4-3 -2 -1-1+1 2 3 4-2+-3+-4+41What is the slope of the line? Explain why the Hitler youth had only mixed success among the young German people. You may use the following in your answer comradeship (friendship), compulsory membership. hi...need help....thank you.. A restaurant customer left $1.35 as a tip...Plz help me Need answers for #3 please hep Identify the number of solutions for the equation below: