hehehdhdhdhdhdhshshshhs​

Hehehdhdhdhdhdhshshshhs

Answers

Answer 1

bghvfdddddcvbnmjkliuytrftfgvvvvv  nbv nbv hjgfdc

Step-by-step explanation:

hgfdcvbnmkloiuytredfxghgcfxchgjnjngjggjjjjjttttttttttttttttrrrrrtkkkkkkkkkkddddddddddddddddddddddddddddddddddujhhhhhhhhgfnmmmmmmmmmhhurtghbfnvbmgjkuttdggggggggggggggggggggggggggggggggggggggggggggggggggggf


Related Questions

The dot plot shows two students’ scores on 12 history quizzes.

Which of the following statements correctly compares the median and the range of their scores?

A. The median of Lolo’s scores is greater that the median of Ami’s scores, and the range of Ami’s scores is greater that the range of Lolo’s scores

B. The medians are equal, and the range of Ami’s scores is greater than the range of Lolo’s scores

C. The medians are equal, and the range of Lolo’s scores is greater than the range of Ami’s scores

D. The median and range of Lolo’s scores are greater than the median and range of Ami’s scores

Answers

Answer:

The correct answer is B

Step-by-step explanation:

Both of their medians are equal and Ami's range is larger than Lolo's range :)

The medians are equal, and the range of Ami’s scores is greater than the range of Lolo’s scores

Option B is the correct answer.

What is median?

It is the middle value of the given set of numbers after arranging the given set of numbers in order.

We have,

Lolo's quiz:

Scores: 12, 13, 13, 14, 14, 14, 15, 16, 16, 17, 17, 19

Median.

= (14 + 15)/2

= 14.5

Range,

= 19 - 12

= 7

Ami's score:

Scores: 10, 12, 12, 13, 13, 14, 15, 16, 17, 17, 18, 18

Median.

= (14 + 15)/2

= 14.5

Range.

= 18 - 10

= 8

We can say that,

The median is the same for both and Ami's range is greater than Lolo's.

Thus,

The medians are equal, and the range of Ami’s scores is greater than the range of Lolo’s scores

Learn more about median here:

https://brainly.com/question/28060453

#SPJ2

HELP!

Eric bought 16 ounces of coffee beans for
$14.40. At this rate, how much would 11 ounces
of coffee beans cost?

Answers

Answer:

11 ounces cost 9.90$.  

Step-by-step explanation:

Each ounce cost .90 cents.

Hope this helped!

Find the missing side. Round to the nearest tenth.

Answers

150 is your answer,hope it helped

Like what that guy said sorry did not mean to disturb

Suppose the TRMS basketball team scored 78 points by 2-point and 3-point baskets only. If 35 total baskets were made, how many 2-point and 3-point baskets were scored?

Answers

Answer:

the number of 2 point and number of 3 point be 27 and 8 respectively

Step-by-step explanation:

Let us assume the number of 2 point be x

And, the number of 3 point be y

Now according to the question

2x + 3y = 78

x + y = 35

Multiply by 2 in equation (2)

2x + 3y = 78

2x + 2y = 70

y = 8

So,

x = 35 - 8

= 27

Hence, the number of 2 point and number of 3 point be 27 and 8 respectively

Which of the following are equivalent to the expression 9/4(1.75−2 1/4)?

Answers

Answer: -1 1/8 (Decimal: -1.125)

Find the volume of the cylinder. Round your answer to the nearest hundredth.

Answers

9514 1404 393

Answer:

  1763.01 m³

Step-by-step explanation:

The height of the cylinder will be ...

  h = (18 m)sin(60°) = 9√3 m

The volume of the cylinder is ...

  V = Bh

where B is the area of the end circle.

  B = πr² = π(6 m)² = 36π m²

Then ...

  V = (36π m²)(9√3 m) ≈ 1763.01 m³

The volume of the cylinder is about 1763.01 m³.

The circumference of the inner circle is 270.04 miles. What is the area of the shaded region?

Answers

area of a circle = [tex]\pi r^{2}[/tex]

circumference =[tex]2\pi r[/tex]

Okay so the center of the circle is the same for both of the circles lets take that value as m so the radius of the inner circle is 54 - m

we have the circumference of the inner circle which is 270.04 we can find the value of m using that

[tex]270.04=2\pi (54-m)\\270.04= 339.2-6.28m \\6.28m = 339.2-270.04\\m= 11.02[/tex]

the radius of the inner circle is therefore 42.98

and the full circle has a radius off 65.02

area of shaded region = area of full circle - area of inner circle

area of shaded region = [tex]\pi (65.02)^{2} - \pi (42.98)^{2}[/tex]

area of shaded region = [tex]13281.39 - 5803.4[/tex]

area of shaded region = 7478 rounded off to the nearest whole number

What is the residual of a customer with a height of 155 cm who rents a bike with a 51 cm frame?

cm

Answers

Answer:

Step-by-step explanation:

What is the residual of a customer with a height of 155 cm who rents a bike with a 51 cm frame?

cm

Answer:

Step-by-step explanation:

-1

(lg 5)²+(lg 2)(lg 50)
need solution....​

Answers

-125g ^2 that’s what I got solving for it

True or false: The following table is linear.

Answers

The table is linear because it goes up at a consistent rate each time.

slope = - 2/5; y-intercept = 0
HELP!!!!!!!!!!!

Answers

Answer:

To form the equation, it would y = -2/5x

Step-by-step explanation:

how do you solve for x

the similarity statement is abc~ xyz​

Answers

Answer:

m<X= 36.87 degrees

Step-by-step explanation:

Since the triangle abc and xyz are similar, hence;

m<C = m<Y

90 = x - 5

Add 5 to both sides

90+5 = x-5+5

95 = x

Swap

x = 95

m<Y = x - 5

m<Y = 95 - 5

m<Y = 90

Find m<X

Using the SOH CAH TOA

Opposite to m<X = YZ = 6

Adjacent = 8

Tan M<X = opp/adj

Tan m<X = 6/8

m<X = arctan(6/8)

m<X= 36.87 degrees

BRAINLIEST FOR CORRECT ANSWER!
What is the transformation rule for a translation 3 units right?

Answers

Answer:Translation happens when we move the image without changing anything in it. ...

Rotation is when we rotate the image by a certain degree. ...

Reflection is when we flip the image along a line (the mirror line). ...

Dilation is when the size of an image is increased or decreased without changing its shape.

PLEASE HELP!!
Find the volume of the following
square pyramid.
Help Resources
8 cm
6 cm
6 cm
V = [?] cm3
Enter

Answers

Answer:

96

Step-by-step explanation:

The volume of the square pyramid is 96 cm³.

How to find the volume of a square pyramid?

You can locate the extent of a normal square pyramid with the use of the volume formula= base location² × height / 3. Take be aware that the bottom vicinity equals the square of the pyramid's base side period. However, the peak is the perpendicular distance between the pyramid's base and the pyramid's vertex.

By using the given formula, we get

V= a² h/3

=6² * 8 / 3 = 96

The answer is 96 cm³.

The volume of a pyramid is found using the formula V = (1/3) B*h, where 'B' is the base area and 'h' is the height of the pyramid.

Learn more about the volume of a pyramid here: https://brainly.com/question/21510592

#SPJ2

Please help due in 5 minutes

Answers

Answer:

18,24,30

Step-by-step explanation:

hope this helps

Answer:

c

Step-by-step explanation:

because that the hypotenuse 30 adjacent 18 and opposite 24

A trapezoid with a height of 8 ft base measuring 11 ft has an area of 112ft find the length of the other base

Answers

Answer:

1.27272727273 I think

Step-by-step explanation:


A light bulb consumes 1800 watt-hours per day. How long does it take to consume 8100 watt-hours?

Answers

Answer:

8100/1800 = 4.5 days

Step-by-step explanation:

!!!!!!!!!!!!!!!!!!!!!

Answers

Answer:

A

Step-by-step explanation:

Answer:

Im gona guess C but im not 100%

Step-by-step explanation:


Select the scenario that could be modeled by each of the given equations. For each equation, the variable c represents the cost and the variable n represents the number of items.

Answers

Answer:

c = 1.41n i think lol

Step-by-step explanation:

Answer:

The correct answers are these.

Step-by-step explanation:

Tina has 3 quarters, 1 dime, and 6 nickels in her pocket.
Find the probability of randomly drawing a nickel?

Answers

Answer:

60%

Step-by-step explanation:

Tina has 3 quarters, 1 dime, and 6 nickels, or 10 coins in total.

They are asking for the probability of drawing a nickel (6 in total). Divide 6 from the total amount of coins:

6/10 = 0.60, or 60%

Tina has a 60% chance of drawing a nickel from her pocket.

~

please help! i'll give brainliest! no one would help me PLEASE.

Answers

Answer:

m∠ABC = 42°

Step-by-step explanation:

5x + 13 + 3x + 33 = 70

8x + 46 = 70

8x = 24

x = 3

m∠ABC = 3(3) + 33 = 42

Where will the two lines intersect? y=2x+1 and y=-2x+5

Answers

Answer:

(1, 3)

Step-by-step explanation:

(1,3) is the answer

Can u please help me??
It would be very helpful if u could write down the answer on a piece of paper(50pts)

Answers

Answer:

Given GP:

tₙ = (1/3)ⁿ⁻¹

We see that:

t₁ = 1, r = 1/3

Sum of  n terms:

Sₙ = t₁(1 - rⁿ)/(1 - r)Sₙ = [1 - (1/3)ⁿ] / (1 - 1/3) = [1 - (1/3)ⁿ] / (2/3) = 3/2 [1 - (1/3)ⁿ] Sₙ = 3/2 [1 - (1/3)ⁿ]

Your scores on the first 4 tests in Algebra were 85, 80, 90, and 93. What do you need to make on the 5th test to have a 90 average in the class?

Answers

Answer:

you would have to get a 100 on your fifth test

Step-by-step explanation:

because between your first 4 tests, the average is only 87 something but when you add 100 to that, the average turns to 89.6 which when rounded becomes 90.

The sequence 18, 9, 9/2, 9/4, 9/8, ... represents the percentage of votes a particular political candidate has according to polls each day after a scandal. The sequence has a common

Answers

Answer:

r = 1/2

Step-by-step explanation:

Given sequence:

18, 9, 9/2, 9/4, 9/8, ...

We can see this is a GP and its common ratio is:

r = 9/8 ÷ 9/4 = 9/4 ÷ 9/2 = 9/2 ÷ 9 = 9 ÷ 18 = 1/2

Common ratio

9/18=1/29/2/9=1/29/4/9/2=1/2

Common ratio is 1/2

could someone give me answers for these three? no wrong answer or spam or link

Answers

Answer:

Equation: 2x + 13 = 5x - 20

x = 11

<FDG = 35

Step-by-step explanation:

These are vertical angles so they're equal to each other:

2x + 13 = 5x - 20

2x - 5x = -20 - 13

-3x = -33

x = 11

<FDG:

5x - 20

5(11) - 20

55 - 20

35

Robert has x books. Marie has twice as many books as Robert has. Together they have 18 books. Which of the following equations can be used to find the number of books that Robert has? Choose one multiple choice answer
x+2=18
x+x+2=18
x+2x=18
2x=18

Answers

Answer:

the answer: x+2x=18

Step-by-step explanation:

What is the perimiter of a quadrilateral with verticles at (5,2), (10,2), (5,5), and (10,5)

Answers

Answer:

55

Step-by-step explanation:

Select the correct answer.
Consider the first four terms of the sequence below.

-3, -12, -48, -192, . . .

What is the 8th term of this sequence?

A.
-196,608
B.
-49,152
C.
-12,288
D.
-768

Answers

Answer:

D

Step-by-step explanation:

The value of 8th term of this sequence is,

⇒ a (8) = - 49,152

What is Geometric sequence?

An sequence has the ratio of every two successive terms is a constant, is called a Geometric sequence.

Given that;

Consider the first four terms of the sequence are,

⇒ -3, -12, -48, -192, . . .

Here, Common ratio is,

⇒ - 12 / - 3

⇒ 4

Thus, The sequence are in Geometric sequence.

Hence, The value of 8th term of this sequence is,

⇒ a (8) = - 3 × (4)⁸⁻¹

⇒ a (8) = - 3 × 4⁷

⇒ a (8) = - 3 × 16,384

⇒ a (8) = - 49,152

Thus, The value of 8th term of this sequence is,

⇒ a (8) = - 49,152

Learn more about the geometric sequence visit:

https://brainly.com/question/25461416

#SPJ7

Please help almost finisHHHH

Answers

Answer:

B. The y-coordinate is positive.

Step-by-step explanation:

Other Questions
Add the two functions. f(x) = 3x3 + 7x 26 g(x) = x + 2 Please help! Thank you! Find the area of the white region in the diagram shown. what is the mRNA in TACCGGATGCCAGATCAAATC? a cup of coffee is left to cool inside a room and its cooling can be described by the function y = 85(.75)x/5 + 15 where x is time in minutes and t is the temperature of the coffee in degrees celsius. Help!!! I do not seem to understand this problem well. Dr. Seals borrows $15,000 to remodel her backyard. The interest rate is 3%. The interest is compounded twice a year for two years. Why would an investor want to choose a certificate of deposit over a corporate bond Please help help me please ASAP I am begging someone please No links or files describe how the state of Washington and its residents played a huge part in winning World War II? Plzzz help NEED THIS FAST!!! What's the circumference of a circle with a radius of 10 inches Explain the lifecycle of mosquito in short A 45 foot ladder is set against the side of a house so that it reaches up 27 feet. If Latanya grabs the ladder at its base and pulls it 3 feet farther from the house, how far up the side of the house will the ladder reach now? (The answer is not 24 ft.) Round to the nearest tenth of a foot. Layla is going to invest $5,200 and leave it in an account for 15 years. Assuming the interest is compounded monthly, what interest rate, to the nearest tenth of a percent, would be required in order for Layla to end up with $13,800? fateful journey what elements of the story did he invent? And what did he alter ? Most Americans consume a varied diet. They eat foods that are both plant- and animal-based. Which words are clues to the meaning of the word consume? A. are both B. eat foods C. animal-based D. Most Americans plz no bit.yl stuff, just answers Sickle cell anemia is a disease that affects the circulatory system.It can be passed from parent to child. Which of the following indicates the significance of this disease?A.It shows that a disease can cause genetic changes.B.It is a reflection of how genetic factors affect health.C.It shows how public health is affected by environmental factors.D.It indicates how a toxin can play a role in the development of disease. Find the surface area of this prism.Round to the nearest tenth. why is it important to save energy in our daily lives Solve for x. Round your answer to the nearest tenth (one decimal place).