Answer:
Quark is a character in the television series Star Trek: Deep Space Nine.
Quark developed a few strong friendships during his stay on Deep Space Nine.
The Ferengi have business deals throughout the galaxy; Quark is no different.
For vegetarians, soft cheeses like cream cheese and quark do not contain any rennet at all.
Explanation:
why is it important to save energy in our daily lives
Answer:
So you can be more active and do different things that need energy
Explanation:
Having energy is an important part of daily life. Without energy, the human body would not be able to go throughout the day without being tired and without their muscles and bones hurting.
Can someone please help me on this plz I beg u :(
Answer:
Coleoptera is correct! Hope this helps.
what are the differences between ligaments & tendons
when are chromosomes (dna) copied?
Answer:
Interphase begins with G1 (G stands for gap) phase. During this phase, the cell makes a variety of proteins that are needed for DNA replication. During S phase, which follows G1 phase, all of the chromosomes are replicated. Following replication, each chromosome now consists of two sister chromatids.
Have a good day. :)
Answer:
Chromosome replication
Explanation:
Chromosome replication is a key event during the cell cycle that must be completed before a cell divides. To reproduce successfully, every cell must replicate its chromosome and distinguish these sister chromosomes from one another.
what is the mRNA in TACCGGATGCCAGATCAAATC?
Answer:
AUGGCCUACGGUCUAGUUUAG
3. Which of the following statements best explains how the cell membrane 1 point
is selectively permeable? *
The movement of specific substances into and out of the cell is controlled by the cell
membrane
The movement of waste substances into, but not out of the cell is controlled by the
cell membrane
The cell membrane is inflexible and cannot control the movement of substances into
and out of the cell
The cell membrane does not surround the cell so it plays no role in the movement of
substances
Answer:
The movement of specific substances into and out of the cell is controlled by the cell membrane.
Explanation:
The cell membrane is permeable, so it allows for the passage of substances both into and out of the cell. It is also selective, so only specific substances can enter and exit the cell.
Number the steps from when a stimulus is received to when the body reacts.
_____ The stimulus is received by sensory receptors.
_____ Motor neurons cause muscles to contract so the body can react to the stimulus.
_____ The brain processes the information through interneurons.
_____ Interneurons transfer response information to motor neurons.
_____ Sensory neurons carry stimulus information to the brain or spinal cord.
Answer:
The correct answer is -
1 - The stimulus is received by sensory receptors.
2 - Sensory neurons carry stimulus information to the brain or spinal cord.
3 - The brain processes the information through interneurons.
4 - Interneurons transfer response information to motor neurons.
5 - Motor neurons cause muscles to contract so the body can react to the stimulus.
Explanation:
In most of the organism including humans body response according to the stimulus it receives. The stimulus is received by the sensory receptors to the sensory neurons or afferent neurons that are present on the skin, nose tongue ears, or eyes. Many other receptors and pain receptors present on various internal organs as well.
These sensory neurons carry the stimulus to the spinal cord or brain where this information received by the stimulus process through interneurons and transfer the response of the particular stimulus to the motor neurons. These motor neurons result in muscles contracts so the body can react.
The Rio Grande River separates Mexico from Texas.
What most likely created the riverbed?
A.glaciers
B.plate collisions
C.volcanoes
D.water erosion
Answer:
d I think or b?
Explanation:
water could cause it to form a river and spread over time
explain how at least three pieces of evidence support the theory of evolution.
Dont put any link or else I won’t give brainlist, just answer.
Answer:
1. Fossil evidence
2. Homologous similarities.
3. Molecular evidence
The energy that powers photosynthesis comes from
A. oxygen.
B. water.
C. the sun.
D. chemicals.
Answer:
sun but am not so sure about it
This is a question that has been confusing - In addition to carbon dioxide, what other two ingredients does a plant need for photosynthesis?
Answer:
Carbon dioxide, water and sunlight
Answer:
water and sunlight
Explanation:
islfso lufe
(Hint: a non-renewable resource, like coal)
CHAPTER
1 what is the term?
Answer:
Fossil fuel
Explanation:
