Answer:
What do you not know?
Explanation:
Sorry I don't see a picture :(
Needed substances are carried to the body cells by:
A)enzymes
B)blood
C)water
D)food
Explica qué son los codones y los anticodones La siguiente secuencia de nucleótidos de ADN codifica para una secuencia de aminoácidos que forman una proteína hipotética, encuentre la secuencia de codones, anticodones y aminoácidos que se forman 5 ` A T G A G C A C C C A A A C T T G C TC T T A T T C T A A A A A G A C T 3
Answer and Explanation:
La informacion genetica de ensamblaje de aminoácidos durante la sitntesis proteica, se almacena en unidades llamadas codones.
Un codón es una secuencia corta de tres nucleotidos provenientes de la cadena de ADN o ARN mensajero. Cada codón representa uno de los 20 aminoácidos disponibles para sintetizar la proteina. En total hay 64 codones, de los cuales 61 codifican aminoácidos (mas de un codón puede codificar para el mismo aminoácido), de los cuales uno de ellos a parte es el codon de inicio de sintesis proteica. Los restantes tres codones corresponden a codones de finalización.
El anticodón es la secuencia de nucleótidos presentes en ARN de transferencia, que complementa a cada codón de ARN mensajero. De esta forma el ARNt reconoce el aminoácido correspondiente y lo ensambla en la nueva proteina.
ADN ⇒ 5 ` ATGAGCACCCAAACTTGCTCTTATTCTAAAAAGACT 3
Codones ATG-AGC-ACC-CAA-ACT-TGC-TCT-TAT-TCT-AAA-AAG-ACT
ARNm ⇒ UACUCGUGGGUUUGAACGAGAAUAAGAUUUUUCUGA
Codones UAC-UCG-UGG-GUU-UGA-ACG-AGA-AUA-AGA-UUU-UUC-UGA
Recordá que para ARNm, la secuencia de nucléotidos debe ser la complementaria para ADN.
Anticodones de ARNt ⇒ Complementarios a los codones de ARNm. Recordá que para los ARN, la timina se reemplaza por uracilo.
AUG-AGC-ACC-CAA-ACU-UGC-UCU-UAU-UCU-AAA-AAG-ACU
La proteina se construye en función de la información del ARNm, es decir que para la selección de aminoácidos, se consideran los codones del ARNm, y no los anticodones de ARNt.
UAC-UCG-UGG-GUU-UGA-ACG-AGA-AUA-AGA-UUU-UUC-UGA
TYR SER TRP VAL Stop THR ARG ILE ARG PHE PHE Stop
Blood is at it's highest pressure just when it leaves the heart. Why so?
Answer: Contractility of the left ventricle myocardium ensures that blood will have enough force to reach the rest of the body.
Explanation: Frank Starling Law....Cardiac output=heart rate x stroke volume.
A 43-year-old Caucasian man with a 20-year history of bipolar disorder presents for the first time with long-term polyuria and polydipsia. He previously took lithium for mood stabilization for 15 years before initiating divalproex sodium therapy. He stopped using lithium because of the polyuria, but he felt that the polyuria never fully subsided. His weight is stable, and he has no other urinary complaints. His blood pressure is 115/80 mmHg and his physical exam is normal. His urinalysis shows no blood, cells, protein, glucose, nitrate, casts, or crystals.
What is the most likely cause of his polyuria?
1 Central diabetes insipidus
2 Nephrogenic diabetes insipidus
3 Polyuria secondary to hyperglycemia
4 Polyuria following acute kidney injury
5 Polyuria secondary to polydipsia
Answer:
The correct option is 2 Nephrogenic diabetes insipidus.
Explanation:
Nephrogenic diabetes insipidus (NDI) occurs when the renal tubule response to vasopressin (ADH) is weakened, resulting in the excretion of large volumes of dilute urine.
As the renal tubules do not respond to vasopressin (antidiuretic hormone) and are unable to reabsorb filtered water back into the body, the kidneys create a high volume of dilute urine in nephrogenic diabetes insipidus.
Nephrogenic diabetes insipidus (NDI) can be inherited or develop as a result of disorders that impede the ability of the kidneys to concentrate.
Therefore, the correct option is 2 Nephrogenic diabetes insipidus.
That is, the most likely cause of his polyuria is nephrogenic diabetes insipidus.
please help me answer this
Answer:
last one a dormancy structure D
Explanation:
It helps keeps bacteria and stuff dormant`
Complete the T-chart by categorizing each environmental factor as something that would most likely increase or decrease genetic variation. Some answers will fit in both columns depending on the situation.
Predator-prey relationships
Competition
Toxins
New habitat
Disasters
Increased food source
A 2-column table has columns with labels Increase variation and decrease variation.
Answer: 1. Decrease 2. Decrease 3. Both 4. Both 5. Decrease 6. Increase
Explanation: I got it right hopefully it helps
Answer:just did it
Explanation:
what are alleles mutations in the dna
Answer:
Mutations Are Recessive or Dominant
Choose three things that blood transports throughout the body.
Nerve impulses
French fries
DNA
nutrients
wastes such as CO2
oxygen
Answer:
nutrientswastes such as CO2oxygenExplanation:
Blood brings oxygen and nutrients to all the parts of the body so they can keep working. Blood carries carbon dioxide and other waste materials to the lungs, kidneys, and digestive system to be removed from the body. Blood also fights infections and carries hormones around the body.
The body's transportation system, the blood, transports innumerable compounds to different parts of the body. Blood carries three things throughout the body: Oxygen, nutrients, and wastes such as carbon dioxide (CO2).
1. Blood carries oxygen from the lungs to all the cells of the body. Cellular respiration requires oxygen to generate the energy (in the form of ATP) that drives many bodily activities.
2. Blood carries nutrients absorbed by the digestive system to cells throughout the body. These nutrients, which are essential for growth, repair and building energy, include glucose, amino acids, fatty acids, vitamins and minerals.
3. Wastes such as [tex]CO_2[/tex]: Removes carbon dioxide from the blood cells, which is a byproduct of cellular metabolism, and carries it to the lungs for expiration. The acid-base balance of the body is maintained by this mechanism.
Learn more about Blood, here:
https://brainly.com/question/32316698
#SPJ6
what do you mean by faunal Diversity
Answer:
animal life especially
Explanation:
i hope it helps
this is my answer
correct me if im wrong
#carryonlearning
What is likely to happen to a healthy population that is experiencing exponential growth ?
What is the main function of the endocrine system?
A. secrete hormones
B. send nerve impulses
C. produce blood cells
D. produce DNA
Answer:
I think the answer to your question is option A , secrete hormones
Plant cell walls connect with other plant cell walls to create plants
A. organelles
B. mega cells
C. vacuoles
D. tissue
Which common resource is being degraded in the photograph?
A. Pastureland
B. Atmosphere
C. Ocean
D. Freshwater
Answer:
b
Explanation:
Which of the following organelles is properly matched to it's function?
lysosome: storage
endoplasmic reticulum: movement
lysosome: digestion
chloroplast: making proteins
The organelle properly matched to it's function is
-(C) lysosome: digestion
Explanation:
Lysosomes : It hold enzymes that were created by the cell. The purpose of the lysosome is to digest things. They might be used to digest food or break down the cell when it dies
Endoplasmic reticulum : to produce proteins for the rest of the cell to function.
Chloroplast : They are responsible to carry out photosynthesis
Nick has had a very stressful job for more than 10 years. At Nick’s annual doctor’s visit, what effects would the doctor most likely identify in Nick?
Answer:
don't known ask the goggle
IS THIS CORRECT?? IF NOT WHATS THE ANSWER PLEASE
When considering ecosystem biodiversity, why would it be dangerous to treat each ecosystem as an isolated environment?
1. each ecosystem has a constant and consistent number of predators
2. rainfall is global occurrence that impacts every ecosystem on the planet
3. environmental conditions appearing in one ecosystem may appear in another
4. there are complex interactions that take place between ecosystems
Answer:
1
Explanation:
they can never be mixed
Why aren't human gonads up near our heart like they are in fish?
IS THIS CORRECT IF NOT WHATS THE ANSWER FAST PLS
The direction of force of Earth's magnetic field is from the geographic South
Pole to the geographic North Pole. Where is Earth's magnetic north pole?
O A. Near Earth's center
O B. Near Earth's equator
O C. Near Earth's North Pole
O D. Near Earth's South Pole
A city installs recycling centers that take wood products. How might the
recycling centers help increase the availability of wood?
O A. Recycling increases the cost of wood.
O B. Recycling increases the consumption of wood.
C. Recycling increases the supply of wood.
D. Recycling increases the demand for wood.
Answer:
C. Recycling increases the supply of wood
Durante el 2° período académico, los estudiantes de 7° de un colegio de Armenia estudiaron los diferentes tejidos vegetales e hicieron un experimento con una planta de fríjol. Para el experimento, regaron con agua únicamente las hojas superiores de la planta, impidiendo por completo la caída de agua a la tierra en la maceta. Al cabo de 1 mes arrancaron la planta de raíz para estudiar esta zona y se dieron cuenta de que, si bien la tierra estuvo completamente seca durante todo el mes, las raíces se habían mantenido bien hidratadas. ¿Qué tejido podría explicar los resultados observados por los estudiantes de 7°?
A Canyon landscape is of economic importance to an area. Explain
how this landscape can be utilized to secure economic sustainability
to the inhabitants.
Answer:
.
Explanation:
............................
The financial advantages of a canyon landscape are contingent on careful management and long-term use. Careful preparation and oversight can ensure that the canyon's natural resources and attractiveness are conserved while also benefiting the local community's economic well-being.
What is Canyon landscape?A canyon landscape is a form of topography characterised by deep and narrow valleys with sides that are steep, which are frequently created over time by a river or other water sources. Canyons varies in size spanning small gorges to enormous networks of interconnected valleys and can be found all over the world, from barren deserts to lush forests.
Canyons are primarily formed by erosive processes that include water, wind, and ice, that erode away the soil and rock gradually over time. The canyon walls get steeper and more prominent as the surrounding ground erodes, creating a distinct environment that is frequently physically attractive and ecologically varied.
Therefore, careful preparation and oversight can ensure that the canyon's natural resources and attractiveness are conserved while also benefiting the local community's economic well-being.
Learn more about Canyon landscape, here:
https://brainly.com/question/22035152
#SPJ2
In what part of the plant are substances transported to where they are needed?
A. Roots
B. Stem
C. Leaves
Answer:
B. Stem.
hope it helps
stay safe healthy and happy.Answer:
B. Stem
Explanation:
In the stem part of the plant are substances transported to where they are needed. So, the option (B) is the correct answer.
what is a good definition of photosynthesis?
A. using glucose to create light
B. putting together lights so we can see
C. using light to put together food (glucose)
Answer:
The best answer is C
Explanation:
Plants use light to create their own food. this is called photosynthesis
Answer:
C
Explanation:
The process of photosynthesis uses light to create food and uses other gas like carbon dioxide.
which process reduces the number of chromosomes by half
Answer:
Meiosis process reduces the number of chromosomes by half.
Explanation:
Meiosis is a type of cell division that reduces the number of chromosomes in the parent cell by half and produces four gamete cells.
Answer:
meiosis
Explanation:
meiosis is a type of cell division that reduces the number of chromosomes in the parent cell by half and produces four gamete cells
What are the products (comes out) of cellular respiration? (select all that apply)
A. Carbon dioxide
B. oxygen
C. Water
D. Glucose (sugar)
What are the products (comes out) of cellular respiration? (select all that apply)
A. Carbon dioxide
B. oxygen
C. Water
D. Glucose (sugar)
Well Well Hello again XD, trust me when i say i'm not stalking you UvU...i'm just really into biology XDAnyway the answer to your question is:
Carbon dioxide and Water!!I apologize if i'm wrong//You're welcome if i'm correct((-Side Note-)): glad i could help lol
I hope you have a great day ^v^"What is the smallest LIVING part of an organism?
A. Molecules
B. Cells
Answer:
Hi, there the answer is a cell
Explanation:
The smallest living part of an organism is a cell. The cell is the smallest structural and functional unit of living organisms, which can exist on its own.
Answer:
B. Cells
Explanation:
The cells are the smallest living part of an organism.
The huge U.S. Army base at Fort Bragg, North Carolina is home to a number of butterflies, plus other endangered animals and plants. Howitzers used during artillery training kill some of the butterflies, but fires started by the howitzer blasts also produce conditions in the base’s forests and wetlands that the butterflies need to survive. This is an example of which characteristic of military bases that makes them useful for conservation?
Answer: Because they cause a disturbed ecosystems.
Explanation: It is evident that the military base provided both survival and elimination platforms for the butterflies species, translating that the butterflies are living in a disturbed ecosystem.
Hence, this provides a good template to understudy conservation for the purpose of maintaining and making wise-use of important wildlife resources and most importantly, the endangered species. Butterflies species dynamics had been used as an important tool for conservation for years now.
helppppppp plzzzzzzzzzzzzzzzzz
Answer:
A
Explanation:
Im not sure what this is but im pretty sure its A it just seems the most logical but once u get someone good to answer this tell me if u got it right or not im curious bhaaajjajaja
