Answers
Explanation:
A is the correct answer in my opinion. Thanks.
Related Questions
What is the purpose of rRNA?
A. to retrieve amino acids
B. to be a working copy of DNA
C. to assemble proteins
D. to replicate the genetic code in mitosis
Answers
Answer:
A
Explanation:
The primary function of rRNA is in protein synthesis – in binding to messenger RNA and transfer RNA to ensure that the codon sequence of the mRNA is translated accurately into amino acid sequence in proteins.
Which organelle is responsible for transporting lipids in the cell? (1 point) O Golgi apparatus O rough ER O nucleus O mitochondrion
Answers
Answer:
Endoplasmic Reticulum (ER)
Explanation:
The organelle that is responsible for transporting lipids in the cell is Golgi apparatus. The correct option is A.
What is Golgi apparatus?A Golgi body, also renowned as a Golgi apparatus, is a cell organelle that aids in the processing along with packaging of proteins as well as lipid molecules, mainly proteins destined for cell export.
The Golgi body is a series of stacked membranes which is basically named after, Camillo Golgi the one who discovered it.
The Golgi apparatus transports, modifies, along with packaging proteins as well as lipids into vesicles for delivery to specific destinations.
The Golgi apparatus is a crucial organelle for cargo post-translational modification.
Golgi-resident enzymes including glycosyltransferases, glycosidases, and kinases mediate post-translational modification of secreted and membrane proteins.
Thus, the correct option is A.
For more details regarding Golgi apparatus, visit:
https://brainly.com/question/12233980
#SPJ2
Which of these is NOT true about vaccines?
a. they simulate a specific immune response
b. they cause memory cells to be produced
c. they contain an antigen of a weakened pathogen
d. it has been proven that there are many possible negative side-effects to being vaccinated
Answers
Answer:
I'm going to say A
Explanation:
because it just make more sense
PLEASE HELP 5TH GRADE SCIENCEEEE AHHHHHHHHH PLEASE HELP ME IM GONNA FAIL IF I DONT GET THIS Alanna spots a bird in her back yard. The bird is sitting on a tree. Explain how the outer coverings of the bird and tree are different and have different functions.
Answers
Answer:
The purpose of the outer covering of the bird helps keep it warm and to help it fly, whilst the outer cover of the tree is to protect it from bugs.
Explanation:
Answer: Bird: helps protect it from the environment. Tree: To help reduce water loss.
Explanation:
The outer covering of the bird helps protect it from cold weather, while the outer covering of the tree helps it to reduce water loss.
Please give it a 5 star!
Need help, I will give branliest
Answers
Answer:
Supergiants
Explanation:
Proteins and polysaccharides are polymers. These polymers are formed by dehydration synthesis. Which statement correctly identifies a difference in the structure of proteins and polysaccharides? *
A. forming a variety of gametes that will pass on hereditary information
B. disrupting meiosis and the synthesis of amino acids into a sequence
C. producing the inorganic molecules needed for normal cell growth
D. directing the synthesis of proteins necessary for proper cell function
Answers
D. directing the synthesis of proteins necessary for proper cell function
I hope this helps a little.
1. Identify the basic characteristics of a house cat and explain why it belongs in the domain Eukarya and the kingdom Animalia?
Answers
Answer:
House cats have a nucleus in their cells which is why its in the domain Eukarya. It belongs in the Kingdom Animalia because it's an animal, classed in it.
Explanation:
Can someone plz help
Answers
A. The passage of genetic instructions for one generation to the next
Herbivores are also called _________________________.
Answers
Answer:
fruitarian, phytophage , vegan, vegetarian , lactovegetarian , or lactarian
Explanation:
I don't know what you're looking for, but I'm pretty sure that all these are basically the same thing as herbivores, correct me if I'm wrong
please help me with my science will give brainlest help asap 2 question, please dont answer just for points :(
Answers
Answer:
1. 50cm
2. Direct
Explanation:
1. The distance pulled back means you get your answer from the distance pulled back data. Since 50cm is the largest of your given data, that makes the cart go farthest.
2. The farther you pull the band back, the farther the cart will go. Since both increase when you increase the distance you pull the band back, this is a direct relationship.
true or false
Only animals have a niche.
Answers
Answer:
False
Explanation:
Answer:
True
Explanation:
PLSSS HELP IMMEDIATELY!!!!! i need help rn!! only help if u know, i’ll give brainiest if u don’t leave a link
Answers
Answer:
Its keen eye sight helps it to see prey from the sky
Explanation:
Second option, doesn't make sense because their white and brown feathers aren't used for camoflouge
Third option, bald eagles fly not swim
Fourth option, bald eagles use their beaks for critical tasks, such as building nests, catching food and preening.
I need help on this one!
Answers
Answer:
Classify I beilieve!
Explanation: You would need to do this because in order for you to study it you would have to classify them.
How does acid rain (deposition) form and travel to effect the environment?
Answers
Answer:
The ecological effects of acid rain are most clearly seen in aquatic environments, such as streams, lakes, and marshes where it can be harmful to fish and other wildlife. As it flows through the soil, acidic rain water can leach aluminum from soil clay particles and then flow into streams and lakes
Explanation:
A science researcher has developed a computer model of the process of DNA replication in a eukaryotic cell. The model includes the following sequence of bases in one strand of the DNA molecule. AACCTGGCCATGGACCTTTATATAAACTAGGAT The researcher wants to revise the model to show the transcription of DNA to form mRNA. Identify the choice that best completes the statement or answers the question. Which of these revisions to the model would be most useful for the researcher to include
Answers
Answer: Identify the promoter and the stop signal (terminator).
Explanation:
DNA is a molecule that contains the genetic information in all living things. This information is used for the synthesis of proteins that make up the body and carry out vital functions of the organism.
The DNA molecule consists of two strands that wind around each other to form a double helix structure, where each strand has a central part formed by sugars (deoxyribose in the case of DNA) and phosphate groups. The four basic components of DNA are nucleotides: adenine (A), thymine (T), guanine (G) and cytosine (C). The nucleotides are joined together (A to T and G to C) by chemical bonds and form base pairs that connect the two strands of DNA. Depending on the sequence of nucleotides (which have different bases), different proteins are synthesized.
DNA replication consists of synthesizing another identical DNA molecule, using enzymes called polymerases, which are molecules specifically dedicated only to copy DNA. Transcription, on the other hand, is the process by which a copy of messenger RNA (mRNA) is generated from the sequence of a gene in the DNA. This RNA molecule leaves the cell nucleus and enters the cytoplasm, where it directs protein synthesis (a polymer made up of many amino acids).
Protein synthesis, or translation, involves translating the sequence of an mRNA molecule into an amino acid sequence during protein synthesis. The genetic code describes the relationship between the sequence of base pairs in a gene and the corresponding sequence of amino acids it encodes. To begin translation, a start codon (set of 3 bases) must first be identified, which is usually AUG that also codes for the amino acid methionine. Then, the codons that follow are read and the corresponding amino acids are added according to the genetic code. The transfer RNA (tRNA) is complementary to the anticodon at specific codons in the messenger RNA and carries the amino acid coding for the codon. In addition, ribosomal RNA (rRNA) is an RNA that is part of ribosomes and is essential for protein synthesis in all living things. rRNAs form the framework of ribosomes and associate with specific proteins to form ribosomal pre-subunits. To finish the translation, a termination codon has to be read, which can be UGA, UAG or UAA.
To revise the model to show transcription to form mRNA, the research should identify the promoter and the stop signal. The promoter is a DNA sequence required to turn a gene on or off. The transcription process starts at the promoter which is usually located near the beginning of a gene and has a binding site for the enzyme that is used to make a messenger RNA (mRNA) molecule. The enzyme RNA polymerase will keep doing the transcription until it reaches a sequence of DNA that is signal which indicates it should stop. This process is called termination, and it happens once the enzyme reaches this sequence, called terminator.
nutrients are transported to the organs of the bloodstream by which system
Answers
Answer:
The blood circulatory system delivers nutrients and oxygen.
Explanation:
What type of microscope would you use to view a live sample?
1. Scanning Electron Microscope
2.Transmission Electron Microscope
3.Magnifying glass
4. Light Microscope
Answers
Answer:
Compound microscopes
Compound microscopes are light illuminated. The image seen with this type of microscope is two dimensional. This microscope is the most commonly used. You can view individual cells, even living ones.
Which of the following connects the right and left hemispheres of the brain, allowing communication between
the to?
Medulla Oblongata
Pons
Corpus Callosum
Brain Stem
Answers
of the following are abiotic factors in an ecosystem except _______.
Select one:
a.
types of minerals
b.
ocean currents
c.
types of bacteria
d.
temperature
Answers
2. Describe the info flow of transcription. (A. DNA --> DNA / B. DNA -> RNA / C. RNA --> protein / D.
DNA --> protein)
3. Describe the info flow of translation. (A. DNA -> DNA / B. DNA -> RNA / C. RNA --> protein / D. DNA-
-> protein)
4. Describe the info flow of expression. (A. DNA --> DNA/B. DNA --> RNA / C. RNA --> protein / D. DNA
--> protein)
5. Describe the info flow of replication. (A. DNA --> DNA/B. DNA --> RNA / C. RNA --> protein / D. DNA-
-> protein)
Answers
Answer:
I think the dna is like in the butt but I really have no key to my hose
Explanation:
jsnfjfnf
What process is typical of cancer? replacement of damaged cells DNA replication cellular death uncontrolled cell division
Answers
Answer:
Cancer is the uncontrolled growth of abnormal cells in the body. Cancer develops when the body's normal control mechanism stops working. Old cells do not die and instead grow out of control, forming new, abnormal cells.
Answer:
D.uncontrolled cell division
Explanation:
edg 2022
I NEED HELP ASAPPP PLEASE
C. When the arm extends (straightens), which muscle contracts?
Answers
Explanation:
When your biceps muscle in your upper arm contracts, it pulls your lower arm in towards your shoulder. However, when it relaxes, your biceps cannot push your arm back out. To do this, your triceps muscle, on the underside of your upper arm, contracts and straightens your arm out.
Answer:
When your biceps muscle in your higher arm contracts, it pulls your lower arm in to your shoulder. when it relaxes, your biceps cant push your arm back out. and straightens your arm out.
Explanation:
2. A mouse running away from the sound of an owl's wings is
an example of the mouse's ability to
A. reproduce
B. grow and develop
C. respond to the environment
D. obtain energy
Check Answer
Answers
Answer:
C Respond to the environment
A mouse running away from the sound of an owl's wings is responding to the environment.
What are living organisms?
The organism which can breathe, reproduce and have the ability to respond to an environment are some of the characteristics of a living organism.
Reproduction is the ability of an organism which gives similar kinds of organisms. Organisms grow and develop through cell division. Cell division is of two types mitosis and meiosis. Mitosis is an equational division.
The organism can respond to the environment. Mouse running away from the sound of an owl's wing is an ability to respond environment. Different organisms can obtain energy from food sources.
Therefore, A mouse running away from the sound of an owl's wings is responding to the environment.
To learn more about sensitivity refer to the link:
https://brainly.com/question/14057226
#SPJ2
A man has Huntington's disease (a dominant trait) and a heterozygous genotype. He has four children with a woman who does not have Huntington's disease. What are the odds their children will inherit Huntington's disease?
Answers
Answer:
50/50
Explanation:
Do you think aluminum foil is a good insulator or conductor? Why? Give data ( I'm talking about numbers here)
Answers
Answer: hewo, There! your Answer is Below ;w;
aluminum foil reflects the emission of heat, it tends to be a better insulator than other materials that just slow down the flow of heat from one area to another. So It is a Good Insulator,
Explanation:
aluminum foil is a good insulator because it prevents the radiation of heat by reflecting it back at the source.
Hope this helps!
Have a great day!!!
-August-
6. The three main regions of the brain that receive and process information are the cerebrum, the cerebellum, and the ____________________________.
Answers
La función del sistema digestivo es digerir los alimentos para que puedan ingresar a las células, al respecto, ¿Qué es digerir?
Answers
Answer:
La digestión es importante para descomponer los alimentos en nutrientes, que el cuerpo usa para obtener energía, crecimiento y reparación celular. La comida y la bebida deben transformarse en moléculas más pequeñas de nutrientes antes de que la sangre las absorba y las lleve a las células de todo el cuerpo. ˗ˏˋ ❤︎ ࿐
Explanation:
Whenever energy appears in one system,
A.
it must have come from somewhere else.
B.
it means the system is suitable for creating energy.
C.
it must be used quickly or it will be permanently lost.
D.
it means energy creation has outpaced energy destruction.
Answers
Answer:
it must have come from somewhere else.
Explanation:
I did it on studyisland
Those individuals that are better able to survive in the Environment tend to be:
Answers
Answer:
Fit
Explanation:
They are the ones who are strong enough to survive.
You cross nonpure tall plants (Tt) and produce 200
offspring. Which of the following statements about
the offspring is correct?
A. All of the offspring will definitely be tall.
B. 150 of the offspring will definitely be tall.
C. There is a 75% chance that each offspring
will be tall.
O D. There is a 25% chance that each offspring
will be tall.
Answers
Answer:
C is the best answer
Explanation:
the dominate trait is in 3 of the four boxes
There is a 75% chance that each offspring will be tall. Therefore option C is correct.
When you cross non-pure tall plants (Tt), you are dealing with a heterozygous genotype, meaning the plants have one dominant (T) and one recessive (t) allele for the height trait.
The dominant allele (T) is responsible for the tall phenotype, while the recessive allele (t) leads to short plants. In this case, 75% of the offspring will likely receive the dominant allele from at least one parent (Tt or TT) and therefore be tall.
The remaining 25% will inherit the recessive allele from both parents (tt) and be short. This is based on the principles of Mendelian genetics and the Punnett square.
Therefore option C There is a 75% chance that each offspring will be tall is correct.
Know more about genotype:
https://brainly.com/question/31515990
#SPJ5
