Help please :) thank u

Help Please :) Thank U

Answers

Answer 1

Answer:

!! neither mechanical nor chemical digestion


Related Questions

islfso lufe
(Hint: a non-renewable resource, like coal)
CHAPTER
1 what is the term?

Answers

Answer:

Fossil fuel

Explanation:

Number the steps from when a stimulus is received to when the body reacts.
_____ The stimulus is received by sensory receptors.

_____ Motor neurons cause muscles to contract so the body can react to the stimulus.

_____ The brain processes the information through interneurons.

_____ Interneurons transfer response information to motor neurons.

_____ Sensory neurons carry stimulus information to the brain or spinal cord.

Answers

Answer:

The correct answer is -

1 - The stimulus is received by sensory receptors.

2 -  Sensory neurons carry stimulus information to the brain or spinal cord.

3 -  The brain processes the information through interneurons.

4 -  Interneurons transfer response information to motor neurons.

5 - Motor neurons cause muscles to contract so the body can react to the stimulus.

Explanation:

In most of the organism including humans body response according to the stimulus it receives. The stimulus is received by the sensory receptors to the sensory neurons or afferent neurons that are present on the skin, nose tongue ears, or eyes. Many other receptors and pain receptors present on various internal organs as well.

These sensory neurons carry the stimulus to the spinal cord or brain where this information received by the stimulus process through interneurons and transfer the response of the particular stimulus to the motor neurons. These motor neurons result in muscles contracts so the body can react.

¿Con que otro nombre se le conoce a las placas de espuma de poliuretano altamente contaminante?

Answers

Answer:

La espluma de poliuretano (espluma PU) ye un material plásticu porosu formáu por un agregamientu de burbuyes, conocíu tamién polos nomes coloquiales de gomaespuma n'España o gomapluma en dellos países suramericanos. Contienen sustances d'escasu poder canceríxenu que si representen dalgún peligru, namái sería tres esposiciones intenses y teniendo contautu direutu.Tamién ye denomináu Poliuretano proxectáu, por cuenta de la forma na que se suel aplicar sobre superficies. Explanation:

DNA is wrapped around
and condensed into chromosomes.

• Genes are used as a set of instructions to produce proteins.

Proteins affect the
and function of organisms.
Chromosome

Answers

Answer:

- DNA is wrapped around nucleosomes and condensed into chromosomes.

- Proteins affect the traits and function of organisms.

Explanation:

Nucleosomes are the basic unit of compaction of DNA. Each nucleosome is composed of ~148 bp double-stranded DNA and an octamer of histone proteins, which include two molecules of each core histone: H2A, H2B, H3 and H4. Subsequently, nucleosomes are packaged into chromatin fibers so they can be densely compacted into chromosomes. On the other hand, proteins are molecules that play important (structural and enzymatic) functions in a cell. These proteins may affect the structure/function of a cell, thereby affecting a certain characteristic/trait to develop.

Will give Brainliest within five minutes of answer - Why do we want to explore Mars more than the other planets/moons even though it is not currently habitable (with its temperatures, atmosphere, etc.)? How can it be habitable?

Answers

Answer:

After the Earth, Mars is the most habitable planet in our solar system due to several reasons:

Its soil contains water to extract

It isn’t too cold or too hot

There is enough sunlight to use solar panels

Gravity on Mars is 38% that of our Earth's, which is believed by many to be sufficient for the human body to adapt to

It has an atmosphere (albeit a thin one) that offers protection from cosmic and the Sun's radiation

The day/night rhythm is very similar to ours here on Earth: a Mars day is 24 hours, 39 minutes and 35 seconds

The only other two celestial bodies in orbits near the Earth are our Moon and Venus. There are far fewer vital resources on the Moon, and a Moon day takes a month. It also does not have an atmosphere to form a barrier against radiation. Venus is a veritable purgatory. The average temperature is over 400 degrees, the barometric pressure is that of 900 meters underwater on Earth, and the cherry on top comes in the form of occasional bouts of acid rain. It also has nights that last for 120 days. Humans cannot live on Mars without the help of technology, but compared to Venus it's paradise!

Additional info:

Mars is an obvious target for exploration because it is close by in our Solar System, but there are many more reasons to explore the Red Planet. The scientific reasons for going to Mars can be summarised by the search for life, understanding the surface and the planet’s evolution, and preparing for future human exploration.

Searching for life on Mars

Understanding whether life existed elsewhere in the Universe beyond Earth is a fundamental question of humankind. Mars is an excellent place to investigate this question because it is the most similar planet to Earth in the Solar System. Evidence suggests that Mars was once full of water, warmer and had a thicker atmosphere, offering a potentially habitable environment.

explain how at least three pieces of evidence support the theory of evolution.

Dont put any link or else I won’t give brainlist, just answer.

Answers

Answer:

1. Fossil evidence

2. Homologous similarities.

3. Molecular evidence

Please help i am giving away brainiliest

Describe the Lytic cycle.

No dam links

Answers

Answer: here ya go

Explanation: The lytic cycle is one of the two cycles of viral reproduction

Answer:The lytic cycle (/ˈlɪtɪk/ LIT-ik) is one of the two cycles of viral reproduction (referring to bacterial viruses or bacteriophages), the other being the lysogenic cycle. The lytic cycle results in the destruction of the infected cell and its membrane.

Explanation:

What two types of consumers are missing from this pyramid?
Please help I need to turn it in today !!!!

Answers

Answer:

decomposers and omnivores

Explanation:

Decomposers and omnivores

what is the mRNA in TACCGGATGCCAGATCAAATC?

Answers

Answer:

AUGGCCUACGGUCUAGUUUAG

what are cotyledons? & what is its use

Answers

Answer:

Cotyledon, seed leaf within the embryo of a seed. Cotyledons help supply the nutrition a plant embryo needs to germinate and become established as a photosynthetic organism and may themselves be a source of nutritional reserves or may aid the embryo in metabolizing nutrition stored elsewhere in the seed.

*You Can put this in your own words

3. Which of the following statements best explains how the cell membrane 1 point
is selectively permeable? *
The movement of specific substances into and out of the cell is controlled by the cell
membrane
The movement of waste substances into, but not out of the cell is controlled by the
cell membrane
The cell membrane is inflexible and cannot control the movement of substances into
and out of the cell
The cell membrane does not surround the cell so it plays no role in the movement of
substances

Answers

Answer:

The movement of specific substances into and out of the cell is controlled by the cell membrane.

Explanation:

The cell membrane is permeable, so it allows for the passage of substances both into and out of the cell. It is also selective, so only specific substances can enter and exit the cell.

Select the correct answer. Which statement about natural selection is true? A. Natural selection and evolution are two terms for the same phenomenon. B. Natural selection is an outdated theory to explain how evolution took place. C. Natural selection is the process by which organisms with more beneficial traits are more likely to survive and reproduce. D. Natural selection is the process by which organisms develop variation in traits, which gives them a better chance of survival.

Answers

Answer:

C. Natural selection is the process by which organisms with more beneficial traits are more likely to survive and reproduce.

Explanation:

Natural selection is an evolutional process by which species of living organisms with stronger or more beneficial traits have higher chances of survival and reproduction. In other words, it is the process by which organisms adapt and survive.

Organisms in a population are all different in their own ways. And those with characteristics or traits better suited for the environment are more likely to survive than those without. The selection prefers more beneficial traits and not wholly on the superiority of the organism. So, the survival and reproduction chance of an organism depends on the presence of traits beneficial to the environment, which is how nature selects. And in this process, those selected will dominate the population while those rejected will be reduced or even die.

Thus, the correct answer is option C.

THIS IS EARTH SCIENCE
PLEADE ASNWER THE Two QUESTIONS IN THE PICTURE

How do ocean currents affect the coastal regions of S.America at 20 degrees south latitude

When a lake freezes over. How does the energy content of the lake change?

Answers

Answer:

Explanation:The remaining air (air that does not descend at 30 degrees North or South latitude) continues toward the poles and is known as the westerly winds, or westerlies

Question: How do ocean currents affect the coastal regions of S.America at 20 degrees south latitudeAnswer: Warm and cold ocean currents can affect the climate of an area along the coast if the winds blow in from the ocean. Warm ocean currents heat the air above the water and carry the warm air to the land, increasing the temperature of the coastal regionQuestion: When a lake freezes over. How does the energy content of the lake change? Answer: Liquid water has more energy than frozen water. When water freezes it gives up some of the water's energy. This energy that is given up is the latent heat of freezing. When the water was freezing latent heat of freezing energy was being released(WATER IS THE LAKE)Bonus: I know that during melting, there is no temperature change as the heat energy is used to do work against potential bond energy but why doesn't temperature change when freezing? Freezing is the opposite process of melting. If the temperature does not increase as the ice melts, the temperature will not decrease as water freezes. Melting and freezing are entropy changes. Entropy measure the amount of disorder in a system. A system, like ice, which has less freedom of motion, has less disorder. A system, like liquid water, which has more freedom of motion, has more disorder. So water has more entropy than ice. Ice is a very ordered arrangement of H2O molecules in a crystalline form. As heat energy is added to ice, the energy is used the break the bonds between the H2O molecules in the ice crystals. So, the temperature remains constant. You might say that the energy that is added to the ice is used to increase the entropy of the system, instead of increasing the temperature of the system.-TAY brainly please

This is a question that has been confusing - In addition to carbon dioxide, what other two ingredients does a plant need for photosynthesis?

Answers

Answer:

Carbon dioxide, water and sunlight

Answer:

water and sunlight

Explanation:

1. Identify the 4 major body systems shown below
A.————
B.————
C.————
D.————

Answers

A. Circulatory system
B. Nervous system
C.respiratory system
D. Digestive system
Hope this helped

I will mark Brainliest for frist answer

Answers

Answer:C, to contain the information

Explanation:

What are the factors that determine

the level of harm an introduced chemical

has on the enviroment?


PLEASE ANSWER QUICKLY

Answers

The factors that determine the level of harm an introduced chemical has on the environment depends on the type of chemical it is, the concentration of the chemical, and weather conditions that are occurring at the time that the chemical was introduced( like air pollution) ( acid rain) ( deforestation) ( desetfication)

Explain the lifecycle of mosquito in short​

Answers

Answer:

Mosquitoes have 4 life stages: egg, larva, pupa and adult. Mosquitoes can live and reproduce inside and outside the home. The entire life cycle, from an egg to an adult, takes approximately 8-10 days. Hope this helps! :)

The Rio Grande River separates Mexico from Texas.

What most likely created the riverbed?
A.glaciers
B.plate collisions
C.volcanoes
D.water erosion

Answers

Answer:

d I think or b?

Explanation:

water could cause it to form a river and spread over time

why is it important to save energy in our daily lives

Answers

Answer:

So you can be more active and do different things that need energy

Explanation:

Having energy is an important part of daily life. Without energy, the human body would not be able to go throughout the day without being tired and without their muscles and bones hurting.


Can someone please help me on this plz I beg u :(

Answers

Answer:

Coleoptera is correct! Hope this helps.

ANSWER IS Coleoptera

Trees in a temperate deciduous forest compete for all of the following EXCEPT -
A sunlight.
B shelter.
C soil.
D water.

Answers

Answer:

B

Explanation:

Trees needs sun, soil (nutrients), and water to grow and become strong.

I hope this helps ^-^

The answer is b hope this helps trees need soil water and sunlight to grow

The term used to describe a location with many different cultural groups is
A. culturally diverse
B. globalization
C. multiple perspectives
D. ethnicity

Answers

A
It’s the only answer that even makes sense if you really think about it.

What organisms are capable of cellular respiration?

A. Heterotrophs only
B. Animals and fungus
C. Animals, fungus, and some bacteria
D. Protists
E. All organisms

Answers

the answer is E. All organisms

plz no bit.yl stuff, just answers
Sickle cell anemia is a disease that affects the circulatory system.It can be passed from parent to child. Which of the following indicates the significance of this disease?
A.It shows that a disease can cause genetic changes.
B.It is a reflection of how genetic factors affect health.
C.It shows how public health is affected by environmental factors.
D.It indicates how a toxin can play a role in the development of disease.

Answers

I think is would be A i hope it helps

what process causes stem cells to become immune system cells,then some immune system cells to become antibodies?

Answers

the answer is hematopoiesis

when are chromosomes (dna) copied?​

Answers

Answer:

Interphase begins with G1 (G stands for gap) phase. During this phase, the cell makes a variety of proteins that are needed for DNA replication. During S phase, which follows G1 phase, all of the chromosomes are replicated. Following replication, each chromosome now consists of two sister chromatids.

Have a good day. :)

Answer:

Chromosome replication

Explanation:

Chromosome replication is a key event during the cell cycle that must be completed before a cell divides. To reproduce successfully, every cell must replicate its chromosome and distinguish these sister chromosomes from one another.

FOODS HIGH IN PROTEIN RELEASES ENERGY
A. FAST
B. QUICKLY
C. SLOWLY​

Answers

Answer:

quickly

Explanation:

Answer:

SLOWLY

Explanation:

the process which takes place in guard cells but not in other epidermal cells is?​

Answers

Answer:

guard cells chloroplasts , involved in the photosynthesis where epidermal cells are living cells covering the outside surface of the herbaceous plants they contain a thick covering of cutting which reduces the water loss from Plants epidermal cells in roots are specialized for water and ion absorption don't know if it helped but good luck

Photosynthesis

The process by which green plants and some other organisms use sunlight to synthesize foods from carbon dioxide and water. The upper and lower epidermal cells do not have chloroplasts, thus photosynthesis does not occur there.

Difference in guard and epidermal Cells:

Two guard cells form a stoma, controlling the gas exchange of the plant by regulating the size of the stoma whereas epidermal cells provide a protection to the plant from the external environment.

Photosynthesis does not take place in epidermal cell because:

The epidermal cells that make up this skin are transparent. As most epidermal cells lack chloroplasts, they can't perform photosynthesis, or the use of sunlight to convert carbon dioxide and water into glucose and oxygen.

Learn more:

brainly.com/question/9498584

Hello! could someone please do a 4 sentence quark poem

Answers

Answer:

Quark is a character in the television series Star Trek: Deep Space Nine.

Quark developed a few strong friendships during his stay on Deep Space Nine.

The Ferengi have business deals throughout the galaxy; Quark is no different.

For vegetarians, soft cheeses like cream cheese and quark do not contain any rennet at all.

Explanation:

Other Questions
need help which contemporary art career best fits this description - a photographer b fashion designer or c multi media designer description uses comp aided design is considered glamorous is good at predicting the future and follows trends and can be useful to rental chains Flash ECard Manufacturing manufactures software parts for the computer software systems that produce ecards. The Flash II part is currently manufactured in the Computer Department. The Data Department also produces the part and the plant has excess capacity to produce the Flash II part. The current market price of the Flash II part is $700. The managerial accountant reported the following manufacturing costs and variable expense data: Flash ECard Manufacturing Manufacturing Costs and Variable Expense Report Flash Component Direct materials $810 Direct labor $160 Variable manufacturing overhead $140 Fixed manufacturing overhead (current production level) $185 Variable selling expenses (only incurred on sales to outside consumers) $136 If the highest acceptable transfer price is $700 in the market, what is the lowest acceptable inhouse price the Data Department should receive to produce the part inhouse at the Computer Department? "810" Which story premise is most clearly a classic tragedy? Who would be invited or inclined to attend a hearing on a bill An architect is allowed 56 square yards of floor space to add a small bedroom to a house. because of the rooms design in relation to the existing structure, the lenght of the rectangular floor must be 6 yards less than 2 Times the width.Find the lenght and width of the rectangular floor that the architect is permitted What were some of Hideki Tojo's actions taken or policies put in place that would be classified as totalitarian? Match the following items.1.uses a lens to gather and focus lightrefracting telescope2. separates starlight into wavelengthsradio telescopes3. pick up faint-lighted starsspectrograph4. see binary starsgiant refractors5. see behind nebulae dustgiant reflectors The product of a number and negative seven is at most negative eighty-four? What is the smallest value of the number? She showed the child some beautiful pictures.(into Passive Voice) can someone please help me asap ill give extra brainly points!!! what's the area of the circle Dishwasher detergent is sold in individual packs is sold in 20, 60 and 90 pack containers which container do you think has the lowest unit rate of dollars per pack and why Describe two realistic demands protestors could bring forward in their peaceful protest so that they dont face the same situation in future the process which takes place in guard cells but not in other epidermal cells is? Sine is positive in which of the following quadrants?A. I and IIIB. I and IVC. T and IID. II and III Please!!!! Write a 500-word report describing some of the efforts of Americans as they supported World War II from the home front. This should include a paragraph about Rosie the Riveter and the government's efforts to encourage women and minorities into becoming part of the work force. Include in your essay specific examples of support for World War II from people who lived in your particular area at that time. Can some please help due by 10will give brainlist to the best answer Central Historical Question: To what extent should the federal government be involved in the election process?Construct an argument that addresses the Central Historical Question using knowledge of federalism, election laws, specific claims, and relevant evidence from sources.In your argument, include the following:A claim that argues what level of involvement (unlimited, limited, or no involvement) the federal government should have in the election process for the statesWhat gives or does not give the federal government permission to be involved in electionsAt least 2 historical examples to support your opinion and assertionsthank you Taylor had a bag of 28 marbles. 5 red, 9 blue, 8 yellow, and 6 black. If Taylor pulled out a yellow one and DID NOT put it back in. What is theprobability of pulling out a blue marble (SIMPLIFY YOUR FRACTION).Blank 1:Blank 2: What is the equation of a line with a y-intercept at (0, 2) and a slope of 3?a. y = 2x + 3C. y = 3x + 2b. y = 3x - 2d. y = -2x + 3 explain how your know that 88is a solution to the equation 1/8 R = 11 complete the sentences The word solution means to 88 is a solution to 1/8 R = 11 because