help plzzzzzzzzzzzzz

Help Plzzzzzzzzzzzzz

Answers

Answer 1

Answer:

sorry I can't help you ok


Related Questions

A rectangle measures 2 2/3 inches by 2 1/3 inches. What is its area? Answer in a mixed number. WILL MARK BRAINLIEST

Answers

answer : 6 2/9
hope this helps out .

What is the minimum y value of the graph above?

Answers

Answer:y=(x)

Step-by-step explanation:

Y=(x)

There is no graph listed here

help me as fast as possible

Answers

Answer:

2040

Step-by-step explanation:

break it into 2 models

(18x3)x20

and

15x(8x8)

(18x3)x20

54x20= 1080

15x(8x8)

15x64=960

add them together

1080+960=2040

there is a bag of 3 apples, 2 oranges, and 2 bananas. you select a fruit without looking and keep it. then you hand the bag to your friend to do the same. what is the probability that you both choose oranges. pls help me!

Answers

Answer:1/7 chance

Step-by-step explanation: 2/7 chance for each, the probability that both are pulled is cut in half, so 1/7

700 students attend Ridgewood Junior High School. 25% of students bring their
lunch to school everyday. How many students brought their lunch to school on
Thursday?

Answers

25% of 700 is 175.
So the answer would be 175.
175 students brought their lunch to school on thursday

The product of a number and negative seven is at most negative eighty-four? What is the smallest value of the number?

Answers

Answer:

Step-by-step explanation:

What is the smallest value of the number?

minimum

The minimum is the smallest value in the data set. The maximum is the largest value in the data set

The product of a number and negative seven is at most negative eighty-four?

8(-4x). X is the number?

Answer:

x(-7)=-84

Step-by-step explanation:

x times -7

12×(-7)

=-84

(no links [repost})
Given that there is one possible outlier. if the outlier was removed from the data set, how would it effect the measures of central tendency? {8, 73, 74, 75, 79, 85, 85, 92, 94}

O Mean increases median decreases
O Mean decreases median increases
O Both mean and median increase
O Both mean and median decrease

Answers

Answer:

A

Step-by-step explanation:

the mean increase and median decreases

Can any1 answer this?If u can i get it right i put brainliest :)

Answers

the first one is the right one i believe

Use the distributive property to write an expression that is equivalent to 12+4x.

Draw a diagram that shows the two expressions are equivalent.



Draw your graph on paper, take a picture, and upload it using the image upload icon

Answers

Answer:

12 + 4x=  (6 x 2) + (2x x 2)

Step-by-step explanation:

this is the pic

I need help please this due in 6 minutes

Answers

Answer:

First one

Step-by-step explanation:

Take Square root of 64/9 which is 8/3.

8/3 is greater than 7/3

Hence,

Square root 64/9 > 7/3

A typical basketball player scores on 70% of free throw attempts. During a basketball practice, Lebron james attempted 40 free throws and was successful on 75% of them. How many free throws did he get? ( Give me methods as to how you got it ) I will mark brainiest who ever explans the most!

Answers

As you may know, 70% is equal to .7. So you just multiply 40 by .7 to get 28, which is the answer.

HEEEEEEEEELLLLPPP EASY
The number of story books owned by eight classmates is shown below:

8, 9, 9, 7, 8, 6, 9, 8

Part A: What is the mean of the data? Show your work. (4 points)

Part B: Use your answer from Part A to calculate the mean absolute deviation for the data. Show your work. (6 points)

Answers

Answer:

Part A: The mean is 8  (count the number in the data set which is 8 then add the numbers which is 64 then divide by 64 by 8 which is 8)

Part B: Absolute Deviation= 0  

shown work for part B:      (subtract each number by the mean)

8-8+9-8+9-8+7-8+8-8+6-8+9-8+8-8=0

(then divide sum by mean) 0 divided by 8 = 8

Step-by-step explanation:

plz can i get Brainliest i tried my best and worked very hard

The number of storybooks owned by eight classmates is shown below: 8, 9, 9, 7, 8, 6, 9, 8. The mean is 8 and Absolute Deviation= 0.

How to find the mean value of a data set?

The mean value of the data set is the ratio of the sum of the data set's values to number of values it has.

If the data set consists of values

x_1, x_2, ..., x_n

, then we get the mean value as:

[tex]\overline{x} = \dfrac{x_1 + x_2 + \cdots + x_n}{n}[/tex]

The number of storybooks owned by eight classmates is shown below:

8, 9, 9, 7, 8, 6, 9, 8

Part A:

[tex]\overline{x} = \dfrac{ 8+ 9+ 9+ 7+ 8+ 6+ 9+ 8}{8}[/tex]

Therefore, The mean is 8

Part B: Absolute Deviation= 0  

subtract each number by the mean

8-8+9-8+9-8+7-8+8-8+6-8+9-8+8-8=0

(then divide sum by mean) 0 divided by 8 = 8

Learn more about mean and median;

https://brainly.com/question/17060266

#SPJ2

No absurd answers or links. Please. It's standard to slope intercept form. I will give brainliest.

Answers

Start from 2x+3y=6 go from each arrow and insert y into the problems

6 out of 18 kids said hello to Mr. Koller this morning. What percent of kids said hello to Mr. Koller?

Answers

33.3333% :) hope this helps

Answer:

Step-by-step explanation:

Simplify 6/18 = 3/9 = 1/3

To turn a percentage into a fraction multiply it by 100.

1/3 * 100 = 33.33333333...(3 goes on forever)  percent

Which rule has a scale factor of 3 and shifts the shape 4 units left and 2 units down?

Answers

Answer: option b

Step-by-step explanation:

Write the equation of an exponential function that satisifies these characteristics:

1. y intercept of (0, -3)
2. Range is all y values less than 0

Answers

Answer:

[tex]f(x)=-3(2)^x[/tex]

Step-by-step explanation:

exponential function in the form f(x)=ab^x

plug in -3 for a :P you didnt give any points so i used a graphing thing to find a value for b that would satisfy the y-int. and its exponential decay so range is less than 0 ^^^^ wooooooooooooo (=^w^=)

Answer:

 y = -3e^x

Step-by-step explanation:

Someone help me pls. Theoretical Probability of compound events.

Answers

Answer:

Step-by-step explanation:

this type of probability is very confusing to most people.  You are in good company. :)

1 ( cheese )  ( salsa) ( veggie )

2 (Burrito) (taco) (wrap)

3

Burrito w/ cheese  = 1/9

taco or wrap w/ salsa = 1/9

so it's (1/9) * (1/9) = 1/81  

best of luck Destinee

On Tuesday, Chris swam 6 laps in 5 1\10 minutes. On Wednesday, he swam the same distance in 4 7\10 minutes. How much faster did he swim on Wednesday?

and please show the answer. 10 extra points for work showed :)

Answers

Answer:

1  6/10 minute

Step-by-step explanation:

Simple subtraction, 5-4=1, 7-1=6, so therefore, Chris swam faster by 1 6/10 minutes.

Answer:

1  6/10 minute

Step-by-step explanation:

i dunno lol

the maximum load of elevator is 480 pounds. Assuming that the average mass of student is 45 pounds, and m represents the number of students in the elevator, how many students can take the elevator at the same time

Answers

we can use the equation 45m < 481

we can replace m to see where it caps.

and the cap is 10.

we can replace m to check our work

45(10) < 481

450 < 481

if you add another student, it would go over the limit.

hope this helps :D


about 10 students can get on a elevator at once

Driving Your brother and sister took turns driving on a 635-mile trip that took 11 hours to complete. Your brother drove at a constant speed of 60 miles per hour and your sister drove at a constant speed of 55 miles per hour. Let x be the number of miles your brother drove and let y be the number of miles your sister drove. Solve the linear system x + y = 11 and 60x + 55y = 635 to find the number of miles each of your siblings drove. Show your work.

Answers

Answer: The brother drove 6 hours and the sister drove 5 hours of the trip

Step-by-step explanation:

Your brother drove 35 miles, and your sister drove 600 miles.

What is the equation?

The equation is defined as mathematical statements that have a minimum of two terms containing variables or numbers that are equal.

We have the following system of equations:

x + y = 11                ....(i)

60x + 55y = 635  ....(ii)

Using the elimination method:

Multiply equation 1 by 55, equation 2 by -1, and add both equations together:

55x + 55y = 605, -60x - 55y = -635

Simplify and solve for x: -5x = -30

x = 6

Substitute this value of x back into equation 1 to find y:

y = 11 - 6 = 5

Thus, your brother drove 35 miles, and your sister drove 635 - 35 = 600 miles.

Learn more about the equation here:

brainly.com/question/10413253

#SPJ2

can someone find da slope? (no links btw or i will report u)

Answers

Answer:

in question 7 there is a slope

coz it starts from y axis and touches the x axis

so in this way it makes a slope

Answer:

7 has a slope

A fisherman is sitting 2 feet above the surface of a lake on a boat. The hook on his fishing pole is floating 6 feet below the lake's surface.



Part A: Which location has the greater absolute value, the fisherman's or his hook's? Explain your reasoning.

Part B: Are the locations of the fisherman and his hook opposites? Explain your reasoning.

Answers

part a: his hook
part b: they are opposites because he is above the surface level so it is +2 and his hook is below surface level which is -6

Ella wants to make a fruit salad for herself and 5 friends.

She has 5 cups of grapes, 3 pints of strawberries, and 1 quart of watermelon pieces.

1. How many cups of fruit salad does Ella have?

2. If she wants to share the fruit salad between herself and 5 friends, how much fruit salad will each person get?
Answer both to get brainlest. Also please explain.

Answers

1. I believe she would have 15 cups of fruit salad because it’s 5 cups of grapes, 6 cups strawberries(1 pint = 2 cups which means 6 cups of strawberries) and 4 cups of watermelon (1 pint = 4 cups
2. Since there are 15 cups of fruit salad you would need to divide 15 by the number of friends which would make it 2.5 cups of fruit salad per person
1.) 15 cups
2.) 3 cups per person

A random sample of dogs at different animal shelters in a city shows that 12 of the 65 dogs are puppies. The city's animal shelters collectively house 1,690 dogs each year. About how many dogs in all of the city's animal shelters are puppies?

Answers

65 because you add then subtract so the you go back to 65
1690 divided by 65 = 26
26 x 12 = 312

Write an equivalent expression for 3(x+4) + 2(x-2) that has only two terms. also if u answer this i will also friend u :3 thx

Answers

Answer:5x+8

Step-by-step explanation:

Amanda completes 18 assignments in 3 days. At that rate, how many assignments would she complete in 7 days?

Answers

Answer: 42

Step-by-step explanation:

Answer:

42

Step-by-step explanation:

6 a day for 7 days

Plz answer ASAP Giving brainliest!

Answers

Answer: g(x) = f(x-2)

Step-by-step explanation:

When plugged into desmos, g(x) = 1/4(2^x) - 4

g(x) = f(x-2) is the only equation that lines up with this equation I stated above.

Note: if you try to do this yourself on desmos graphing calculator, make sure to add f(x) first (f(x) is: f(x) = 2^x - 4).

if ben makes $35.00 per hour and then gets a ten percent raise what is his new salary. Show your work

Answers

Answer:

$38.50 per hour

Step-by-step explanation:

10% = 0.1

0.1 × 35.00 = 3.50

35.00 + 3.50 = 38.50

Answer:

The answer is $38.50

Step-by-step explanation:

35 x 0.1 = 3.5 (0)

35 + 3.50 = 38.50

The reason we do 0.1 is because 10% written in decimal form is 0.1 and since 35.00 is a decimal we made the percent into a decimal to make it even.

please help me i am struggling with math

Answers

Answer:

1 hour and 45 minutes

Step-by-step explanation:

3 goes into 1/2 6 times.

multiply 9 and 6 to get the distance she needs to travel.

distance is 54 miles in total.

then i used a distance and speed calculator to determine 30 mph to travel 54 miles. that got the answer 1 hour and 45 minutes.

The base of a triangle is 9 units more than h, its height. Write an algebraic expression that represents its area in terms of h

Answers

Answer:

Step-by-step explanation:

cn n .mxn

Other Questions
Find the area of the white region in the diagram shown. what is the mRNA in TACCGGATGCCAGATCAAATC? a cup of coffee is left to cool inside a room and its cooling can be described by the function y = 85(.75)x/5 + 15 where x is time in minutes and t is the temperature of the coffee in degrees celsius. Help!!! I do not seem to understand this problem well. Dr. Seals borrows $15,000 to remodel her backyard. The interest rate is 3%. The interest is compounded twice a year for two years. Why would an investor want to choose a certificate of deposit over a corporate bond Please help help me please ASAP I am begging someone please No links or files describe how the state of Washington and its residents played a huge part in winning World War II? Plzzz help NEED THIS FAST!!! What's the circumference of a circle with a radius of 10 inches Explain the lifecycle of mosquito in short A 45 foot ladder is set against the side of a house so that it reaches up 27 feet. If Latanya grabs the ladder at its base and pulls it 3 feet farther from the house, how far up the side of the house will the ladder reach now? (The answer is not 24 ft.) Round to the nearest tenth of a foot. Layla is going to invest $5,200 and leave it in an account for 15 years. Assuming the interest is compounded monthly, what interest rate, to the nearest tenth of a percent, would be required in order for Layla to end up with $13,800? fateful journey what elements of the story did he invent? And what did he alter ? The modern women's movement arose as more womena questioned their roles in society.b. applied for civil service jobs.C. worked in the home.demanded equal voting rights.Please select the best answer from the choices provided DYes Most Americans consume a varied diet. They eat foods that are both plant- and animal-based. Which words are clues to the meaning of the word consume? A. are both B. eat foods C. animal-based D. Most Americans plz no bit.yl stuff, just answers Sickle cell anemia is a disease that affects the circulatory system.It can be passed from parent to child. Which of the following indicates the significance of this disease?A.It shows that a disease can cause genetic changes.B.It is a reflection of how genetic factors affect health.C.It shows how public health is affected by environmental factors.D.It indicates how a toxin can play a role in the development of disease. Find the surface area of this prism.Round to the nearest tenth. why is it important to save energy in our daily lives Solve for x. Round your answer to the nearest tenth (one decimal place). Lila collected rain water for three days. On the first day she collected 23 liter of rain water. The last two days yielded 14 liter each how much did lila collect in all