HELP right now please! No websites

HELP Right Now Please! No Websites

Answers

Answer 1
Carbon dioxide is the name of the molecule I believe
Answer 2
CO2. Carbon Monoxide

Related Questions

Bill Nye Earth's crust

Answers

1. rock
2. on
3. mantle
4. volcanoes
5. active
6. lava
7. hot
8. coolest
9. geyser
10. resistant
11. tectonic
12. tectonic/pangea
13. caves
14. earthquake
15. crust

Answer:

1. rock

2. on

3. mantle

4. volcanoes

5. active

6. lava

7. hot

8. coolest

9. geyser

10. resistant

11. tectonic

12. tectonic/pangea

13. caves

14. earthquake

15. crust

Explanation:


Can someone please help me on this plz I beg u :(

Answers

Answer:

Coleoptera is correct! Hope this helps.

ANSWER IS Coleoptera

Explain the lifecycle of mosquito in short​

Answers

Answer:

Mosquitoes have 4 life stages: egg, larva, pupa and adult. Mosquitoes can live and reproduce inside and outside the home. The entire life cycle, from an egg to an adult, takes approximately 8-10 days. Hope this helps! :)

what are the differences between ligaments & tendons

Answers

Basically ligaments connect and tendons bridge

Which process begins the formation of sedimentary rock?

Answers

Weathering breaks down pre-existing rock into particles, while erosion moves the particles to a site of deposition. These processes begin the formation of sedimentary rock. ... Sediment can be moved by wind, running water, ice, or waves.

explain how at least three pieces of evidence support the theory of evolution.

Dont put any link or else I won’t give brainlist, just answer.

Answers

Answer:

1. Fossil evidence

2. Homologous similarities.

3. Molecular evidence


Which statement below is NOT a statement within the Cell Theory?
A. all cells come from other cells
B. all organisms are composed of cells
C. the cell is the basic unit or organization of organisms
D. all cells contain DNA (genetic information)

Answers

The best answer to go with is b you’re welcome

help-- multiple choice!
Biogenic sediment is made of at least 30 percent...

acidic chemicals

alkaline properties

limestone or other rock

skeletal remains

Answers

Answer:

The answer is the last one, skeletal remains

Answer: Skeletal remains

why is it important to save energy in our daily lives

Answers

Answer:

So you can be more active and do different things that need energy

Explanation:

Having energy is an important part of daily life. Without energy, the human body would not be able to go throughout the day without being tired and without their muscles and bones hurting.

¿Con que otro nombre se le conoce a las placas de espuma de poliuretano altamente contaminante?

Answers

Answer:

La espluma de poliuretano (espluma PU) ye un material plásticu porosu formáu por un agregamientu de burbuyes, conocíu tamién polos nomes coloquiales de gomaespuma n'España o gomapluma en dellos países suramericanos. Contienen sustances d'escasu poder canceríxenu que si representen dalgún peligru, namái sería tres esposiciones intenses y teniendo contautu direutu.Tamién ye denomináu Poliuretano proxectáu, por cuenta de la forma na que se suel aplicar sobre superficies. Explanation:

Number the steps from when a stimulus is received to when the body reacts.
_____ The stimulus is received by sensory receptors.

_____ Motor neurons cause muscles to contract so the body can react to the stimulus.

_____ The brain processes the information through interneurons.

_____ Interneurons transfer response information to motor neurons.

_____ Sensory neurons carry stimulus information to the brain or spinal cord.

Answers

Answer:

The correct answer is -

1 - The stimulus is received by sensory receptors.

2 -  Sensory neurons carry stimulus information to the brain or spinal cord.

3 -  The brain processes the information through interneurons.

4 -  Interneurons transfer response information to motor neurons.

5 - Motor neurons cause muscles to contract so the body can react to the stimulus.

Explanation:

In most of the organism including humans body response according to the stimulus it receives. The stimulus is received by the sensory receptors to the sensory neurons or afferent neurons that are present on the skin, nose tongue ears, or eyes. Many other receptors and pain receptors present on various internal organs as well.

These sensory neurons carry the stimulus to the spinal cord or brain where this information received by the stimulus process through interneurons and transfer the response of the particular stimulus to the motor neurons. These motor neurons result in muscles contracts so the body can react.

Which organelle of a cell functions similarly to the envelope of a virus and why?

Answers

Answer: linear or circular. include genes encoding viral proteins: capsid, envelope proteins, any polymerase not found in the host cell. viruses may have a lipid envelope.

B) Now imagine that a hurricane has deposited large patches of light colored sand among the
rocks. Use the axes below to sketch how you think your graph from part A would change under
these new conditions. What type of selection is acting under these new conditions?

Answers

Here's li[tex]^{}[/tex]nk to the answer:

bit.[tex]^{}[/tex]ly/3tZxaCQ

How is energy produced by respiration stored

Answers

Answer:

Explanation:

Cellular respiration converts the chemical energy stored in glucose into chemical energy stored in the ATP molecule. The cells break glucose down into carbon dioxide and water while producing energy that they store in ATP molecules.

Answered by the ONE & Only #QUEEN aka  #DRIPPQUEENMO

Hope this helped!!!

This moray eel has a small fish cleaning between its teeth. The eel gets a
clean mouth while the cleaner fish gets a nice meal.
A.Mutualism
B.Commensalism
C.Parasitism

Answers

Answer:

A. Mutualism

Explanation:

The moray eel and the small fish are both getting something out of it. Meaning they both benefit from each other.

A.Mutualism. hshshshshs

What is the relationship between the rock cycle and the plate tectonics?

Answers

Answer: The metamorphic rocks can erode into sedimentary rocks which can turn into igneous rock. Metamorphic rocks in the rock cycle is driven by tectonic plates.

Explanation:

In males, the 4 haploid or diploid cells at the end of Meiosis 2 become 4 sperm cells.

Answers

Is this supposed to be a true or false question I’m kind of confused sorry that I can’t help out

not all words are used.
will mark brainliest if correct.

Answers

Answer:

I D K

Explanation:

I just wasted 10 minutes on this and I am so confused:)

what is the mRNA in TACCGGATGCCAGATCAAATC?

Answers

Answer:

AUGGCCUACGGUCUAGUUUAG

When a person loses consciousness due to a head injury from a car crash, the ______ keeps the body functioning by regulating the flow of information between the brain and the rest of the body

Answers

Answer:

Brain stem

Explanation:

I hope this helps

Earth science question. Please help

Answers

Answer:

answer choice 4, more rain and a steeper slope cause it to flow faster

Explanation:

what does the respritory system do?

Answers

Answer:

The respiratory system's main job is to move fresh air into your body while also removing waste gases.

Explanation:

Your lungs are part of the respiratory system, a group of organs and tissues that work together to help you breathe.

The energy that powers photosynthesis comes from
A. oxygen.

B. water.

C. the sun.

D. chemicals.

Answers

Answer:

sun but am not so sure about it

This is a question that has been confusing - In addition to carbon dioxide, what other two ingredients does a plant need for photosynthesis?

Answers

Answer:

Carbon dioxide, water and sunlight

Answer:

water and sunlight

Explanation:

help................

Answers

The top left, would be light energy from the sun, while the top of the circle would be living beings. Think about it just like plants that that gain energy from the sun through photosynthesis. Then the bottom of the circle would be nonliving beings, either decomposed plants or animals that bring nutrients to soil, or dead ones that we eat. This cycles through until the energy is rereleased through heat. Therefore the top right would be heat energy, every living thing on earth creates gradual amounts of heat. Imagine going for a run, you'll probably be hotter afterwards right? I know it's not the most scientific answer but its 100% right.

Hope this helps!

I will mark Brainliest for frist answer

Answers

Answer:C, to contain the information

Explanation:

what process causes stem cells to become immune system cells,then some immune system cells to become antibodies?

Answers

the answer is hematopoiesis

3 examples of radioactive dating?

Answers

Answer:

Uranium 238

Potassium 40

Rubidium 87

Explanation:

Cell differentiation causes embryonic
cells to become which of these cells? A) prokaryotic cells B) specialized cells C) stem cells

Answers

Answer c

Explanation:

plz no bit.yl stuff, just answers
Sickle cell anemia is a disease that affects the circulatory system.It can be passed from parent to child. Which of the following indicates the significance of this disease?
A.It shows that a disease can cause genetic changes.
B.It is a reflection of how genetic factors affect health.
C.It shows how public health is affected by environmental factors.
D.It indicates how a toxin can play a role in the development of disease.

Answers

I think is would be A i hope it helps
Other Questions
Find the value of x. ILL MARK BRAINLIEST TO FIRST PERSON THAT ANSWERS CORRECTLY! Annita baby sits at a rate of $7 per hour. Identify the type of relationship this represents. Explain your answer. HURRY PLEASE HELP What is the theme of the passage?A. Taking advice from others may prove to be beneficial.B. Overloading oneself can lead to unforeseen consequences.C. Relaxation and meditation are important activities.D. One must take care when doing activities after school. What is the value of tan x What do we learn from seeing Obama before, during, and after recording TheColbert Report?A. That he is always stern, serious, and businesslikeB. That he is not capable of sharing humor or taking jokesC. That he is a serious leader who can be light and funnyD. That if he were not a politician, he could be a comedian Due in 30 minutes!Who stopped the English kings from becoming an absolute monarchy and why? how is the periodic table important for all of science and not just chemistry? pleas answer me Use the distributive property to write an expression that is equivalent to 12+4x.Draw a diagram that shows the two expressions are equivalent.Draw your graph on paper, take a picture, and upload it using the image upload icon Did the Olmecs settle near a river? What is the name of the area? To evaluate a program designed to improve math scores for elementary school girls, girls were divided into treatment and control groups. Girls in the treatment group were required to attend an after-school program, while girls in the control group went home on time. Math exam scores were then compared between the two groups of girls. This type of program design is associated with: Divide the polynomial in the numerator by the monomial in the denominator. Simplify your answer. 20x^5 6x^4 + 12x^3 + 12x^2 10x^2 Please help ill give brainlest I did my best to fit it all lol, can someone please help? Hello, please help me!Rewrite this passage so that it includes at least one compound, complex, or compound-complex sentence. You should not get up. You should not make dinner. You think you feel fine. You need to stay in bed. You are sick. You need to give your body a chance to get well. You will only get better with rest. PLEASE HELP MEA student bought 24 pencils for every 16 markers. The number of pencils bought is directly proportional to the number of markers.What is the constant of proportionality that relates the number of pencils to the number of markers?5/32/33/23/5 1. (01.01 LC)Escoge la mejor opcin para completar la frase con las palabras correctas. Choose the best option to complete the sentence with the correct words.El azabache ayuda a proteger contra(1 point)la santeriaO la religin catlicao el mal de ojoel amuleto A 45.7 kg woman starts from rest at the bottom of a flight of stairs that hasa total height of 2.54 meters. She reaches the top of the stairsin 5.00 seconds. How much power does she generate if she is moving at2.63 m/s at the top of the stairs? Use g = 9.8 m/s2, and only include 3numbers in your answer. Taxes upon earnings are____taxes.incomeseveranceexcisesales please change the verb in the parentheses to the correct preterite form to match the subject .El viernes pasado nosotros_______(recibir) unos correos electrnicos. the maximum load of elevator is 480 pounds. Assuming that the average mass of student is 45 pounds, and m represents the number of students in the elevator, how many students can take the elevator at the same time