Hi, can you guys give me some good Title names for a goog.le slides I'm working on, it's about Llamas. So I need a good Title name for it. Keep it professional!! I hope you help me! And Thank you! :D​

Answers

Answer 1

Answer:

-Facts about Llamas

-Everything you should know about Llamas

Explanation:


Related Questions

1) Read these sentences from "For special-needs kids, Buddy Baseball lives up to its name":
Giambalvo was inspired to become a buddy at the Wheaton program after watching her older brother participate. She recalls being unsure of how to gain the trust of Dungan when they were introduced.

2) Would it be a good idea to combine these two sentences using a semicolon? Explain why or why not using the following sentence stem:
Joining these two sentences with a semicolon would be a __________ (good or bad) idea because...

Answers

Answer:

Yes

Explanation: Why not do it?

If anybody wants a friend and/or someone who can help them in any way, click here and tell me. I can help.

Answers

Answer:

Ok.

Explanation:

what do i put in the chart

Answers

You don’t put anything, it’s already filled out.
You don’t put anything.

A masked allele in the genotype that is only expressed when 2 of the same masked alleles are inherited Question 1 options: dominant trait recessive trait genotype phenotype

Answers

Answer: phenotype

Explanation:

just took test

Alleles allude to the elective type of a similar quality. These are for the most part of two sorts prevailing and latent allele.

What are alleles in genetics?

The kind of allele that overwhelms and veils one more allele for a similar attribute is known as a predominant allele while the allele that gets covered within the sight of the prevailing is known as a passive allele.

The allele conveying a similar hereditary quality in an unadulterated structure is called thoroughbred while the allele that has various structures for the particular property is called heterozygous.

For more information about allele, refer the following link:

https://brainly.com/question/13324975

How does the repetition of the line “It is July” affect the meaning of the poem?

It helps convey the slow and restful nature of the summer.

It suggests a feeling of high energy after a period of rest.

It acts as a reminder to wake up from the sleepiness that heat can induce.

It helps indicate the finite quality of the season as autumn approaches.

Answers

Answer:

A) It helps convey the slow and restful nature of the summer.

Explanation:

just took the testtt

The repetition of the line “It is July” that has an effect on the meaning of the poem was that it helps convey the slow and restful nature of the summer. Hence, Option A is correct.

What is repetition?

Repetition is the straightforward repetition of a word within a few words without deliberate placement of the words to emphasise a point. It is a multilingual written or spoken device, widely employed in English and several other languages, including Hindi and Chinese, and is so infrequently referred to as a figure of speech.

A literary device called repetition is the repeated use of a word or phrase. All of literature uses repetition in some way. To generate rhythm or accentuate a word or phrase, it is most frequently used in poetry and speeches.

The idea that learning material is often retained better when it is shown to the brain repeatedly. Although there are variations and modifications, the repetition effect is a general learning principle.

Therefore, Option A is correct.

Learn more about repetition from here:

https://brainly.com/question/28084537

#SPJ2

How does the final stanza contribute to the development of the poem's theme?

Answers

The final stanza contribute because everyone has a friend that we enjoy being around, and that we would be sad if they left us. "We have been sad together - oh what shall part us now?" (lines 23-24) This means that when we had been through thick and thin, you're there for them, you stick with them no matter what.

Identify this conjunction.

as long as

conjunctive adverb
correlative
coordinating conjunction
subordinating conjunction

Answers

Subordinating conjunction

Which of these sentences uses metaphor?​

Answers

I don’t see sentences

Which line from the text most clearly explains why teenagers have trouble with decisions?
You see, most adult humans use their cerebral cortex to make decisions
The amygdala talks to other parts of the brain about events related to rewards and fear
We simply don't have the tools to control those emotions and impulses
Society doesn't consider children to be adults and after they are 18

Answers

The best answer should be the first option because it shows a relevant scientific reason. The other statements lack a scientific explanation that is relevant to decision making.

Answer:

The best answer should be the first option because it shows a relevant scientific reason. The other statements lack a scientific explanation that is relevant to decision making.Explanation:

To what does the heading "Distraction/Rate" refer?
(WILL GIVE BRAINLIEST)

Answers

Answer:

distraction rate in do describes the distance in millimeter in which the bone is moved per day and distraction rhythm describes the frequency of device activation per day

Explanation:

i mean i g00gled it uh here

Read the excerpt from Trifles. SHERIFF. Nothing here but kitchen things. (The County Attorney, after again looking around the kitchen, opens the door of a cupboard closet. He gets up on a chair and looks on a shelf. Pulls his hand away, sticky.) COUNTY ATTORNEY. Here's a nice mess. (The women draw nearer.) How would an audio recording of this excerpt help establish the setting of the play?

Answers

Answer:

The audio shows that the characters are in a very messy kitchen, which would help in representing a scenario for this scene.

Explanation:

The setting is the place where a scene takes place. In the case of the scene presented above, we could promote a representation of the scenario through the speeches of the characters present in the scene. In the sheriff's speech we can see that he is in the kitchen of a house, because he says that the environment where he is only has "kitchen things." In addition, we can see that the kitchen is completely messed up, when the County attorney says "here's a nice mess".

"Trifles" is a play presented in a single act, which presents the investigation into the murder of John Wright. The investigation takes place at John's own home, since his wife is the prime suspect.

D. through the sound effect of footsteps around the kitchen

edge 2021

Which phrase about covering your sneeze makes the best slogan?

A. Cover your sneeze with a tissue to block germs!
B. Cover your sneeze, prevent disease!
C. Don’t forget to use a tissue!

Answers

Answer:

Explanation:

B

Answer:

B

Explanation:

ICU by Grace chua. How does the poet's use of the phrase "I can't see" in stanza 3 help
develop the theme of the poem?

Answers

Answer and Explanation:

"ICU" by Grace Chua is a poem that deals with the loss of a loved one and the understanding we have of death. The last stanza is the following:

But I can't see

for the life of me

the far-off

places

to which

you

stray

When the speaker says that she "can't see" those places, she means she cannot understand death nor what happens after it. She can surely understand pain. As she watches her loved one lying in a hospital bed, she can sense death is only a matter of time. She knows that person will soon be gone, and that she will hurt because of it. But where will that person go? What happens then? That is something she cannot see.

The correct write yes if it wrong correct the answer now tell me in the bottom by typing the answer

Answers

yes!!!!!!!!!!!!!!!!!(;)$&!!

Identify where a comma should be placed by choosing the word after which the comma should be placed. If there is no error, mark the answer for “No error.”

Elizabeth is looking forward to the summer camp yet it means she will need to be away from her family for two weeks.

Elizabeth
camp
away
No error

Answers

Answer:

The answer is Camp.

Explanation:

add hearts and Good luck!!! ^w^

Answer: b

Explanation:

Which element of writing is best suited for an informal tone and an inexperienced audience?
O A. slang
ОВ.
technical terms
O c. long sentences
OD. jargon
E.
complex phrasing

Answers

The answer for this is C:long sentences
Tell me if I’m wrong

Please help I’ll give brainlist!!!!!!!
Match each inference strategy with its description.
Drag the correct tile to each box.

Answers

Answer:

Involves noticing interesting language and info -> locate key details

involves making predictions -> use active reading strategies

involves drawing upon knowledge --> connect to your outside knowledge

involves paying attention... ->noticing patterns and relationships

5. What does the author intend to inform the reader about Piggy in the following quote? “Piggy could think. He could go step by step inside that fat head of his, only Piggy was no chief. But Piggy, for all his ludicrous body, had brains. (78)" a. Piggy is logical, intelligent and has good ideas. b. Piggy is physically incapable of doing much manual labor. C. While Piggy has some things to offer the others, leadership is not one of them. d. All of the above e. A and B, but not C​

Answers

Answer:

d. All of the above

Explanation:

From the given quote about Piggy, the author describes Piggy as having a "ludicrous body" which means his body is out of place and amusing, which indirectly infers that he is unable to do much manual labor.

The author also describes Piggy as someone who could think, and go "step by step" inside his head, which implies that he is logical, intelligent and had good ideas.

Furthermore, Piggy is described as not being a "chief" which implies that he was not cut out to be a leader and didn't have leadership qualities.

Therefore, the correct answer is option D. All of the above.

Light travels fast and in a _______________.
A.wavy line
B.blue line
C.compression wave
D.straight line

Answers

straight line i think...

How are all the species in a food chain similar to links in a metal chain

Answers

Answer:

They're similar because in a food chain, if you take away one animal the whole chain breaks, and with a metal chain, if you take away one link, the entire chain falls apart.

which of Lagos manipulation had been the most egregious from the play othello

Answers

Answer: Iago's manipulation of Othello is one the most dangerous because it results in the death of others. Iago doesn't even need to do any physical action but just by his use of words. Iago's need for revenge on Othello seems to change throughout the play meaning that even Iago isn't too sure why he is doing it

A magazine publisher has decided to buy a new printing press. It is so large, it will fill an entire room. What type of product have they purchased?

Major equipment

Business service

Accessory equipment

Component part

Answers

Answer:

The product is classified as Major Equipment

What should you do first when planning a research report?

b. Determine if the topic is currently popular and has lots of information available.

c. Make sure the topic interests you and also fits the assignment for the report.

Answers

The answer your looking for is c

Make sure the topic interests you and also fits the assignment for the report. This is first thing to do when planning a research report.

What is the meaning of research paper?

A research paper is an article in which you describe what you have learned after examining your topic in depth. In the research paper, you include information from sources such as books, articles, interviews, and online sites

What are the types of research paper?

The types of research paper are:

AnalyticalDefinitionInterpretativeSurvey

Hence, the correct answer is Option C.

Learn more about research paper on brainly.com/question/968894

#SPJ2

fill in the blanks with suitable adverbs. Do you __travell on weekends?​

Answers

Answer:

Here are 5 that would work!

Explanation:

Diligently

Cheerfully

Cautiously

Excitedly

Energetically

Is Willy Loman an innocent victim of the society in which he lives, or are there flaws in his character that make him at least partially responsible for his own misfortune?

Answers

Answer:

innocent victim of society

Convert this simple sentence into compound and complex by expand it and using conjunctions.
"I finished my homework"​

Answers

Answer:

I finished my homework, and I think I will go play with Lucy, my dog!

Explanation:

Hope this helps...:)

10
1. Please give this check to ( she , her)

Answers

Answer:

okay i sure will

Explanation:

dabi is the CEO of hot topic this guy has like 35 face piercings this is the guy i would take him to my parents and make them jealous

Answers

Answer:

get ig

Explanation:

Name 3 things the evacuees are expected to carry with them on departure

Answers

Answer:

A gas mask with the case, a change of underclothes, night clothes, slippers, socks, toothbrush, comb, towel, soap, face cloth, handkerchiefs and a warm coat.

Explanation:

Basically everything needed for a sleepover....minus the gas mask.

By this time I was in a state of considerable nervous tension, although to my reason
there was no adequate cause for my condition. My mind, however, was perfectly
clear. I postulated quite unreservedly that nothing supernatural could happen, and to pass the time I began stringing some rhymes together, Ingoldsby fashion, concerning the original legend of the place.
What is the meaning of the word postulated as it is used in this passage?

A. Claimed
B. Demanded
C. Hoped
D. Proved

Answers

Answer:

C. Hoped

Explanation:

Other Questions
What is the length of the missing leg?45 and 36 Which statement best describes a difference between a molecule of DNA and a molecule of RNA? A)DNA contains genetic informationwhile RNA does not B)RNA contains the letter in place of the letter T in DNA C)DNA has 1 strand, while RNA has 2 D)RNA uses the letter C. while DNA does not NEED HELP WITH THESE f(x)=x^2-x+1g(x) = 5 - 3xEvaluate the following.1) f(-1)2)g( -8)3)f( 1)4) g(5)5) f(3)6) g(-3) What is Isolated system How many repeats are there for this STR? Refer to the following DNA sequence to answer the questions: CTAGAAGCTTAAAGCTTCATCATCATCATCATCATCATTTAAGCTTCAAAGCTT At one time, dinosaurs were rulers of the earth. What are the nouns? Hello, I need help in this part of chemistry, I need the chemical names of the following four:1) B and F32) Se and I23) As2 and Se3ASAP! Please,,, 25 ft 8 yd 11 in.Which is greater? NO SCAM LINKS. please reply ASAP PLEASEEEE I'LL GIVE YOU BRAINLIEST!!Which is the best definition of air pressure? *1 pointthe weight of the air pressing on everything in the environmentthe amount of precipitation in a certain areathe type of clouds in the atmospherethe amount of water vapor in the air Can I have some help with this math? Pls hurry, I will mark brainliest Evaluate the expression 4 25 . I have to find the missing angles In what Century did people learn how traits pass from one living being to itsdescendants? Find the sum or typeimpossible"Help Resources[1 -2 1] + [4 -5 -6]Skip[[?]Enter Texas Roadhouse opened a new restaurant in October. During its first three months of operation, the restaurant sold gift cards in various amounts totaling $1,800. The cards are redeemable for meals within one year of the purchase date. Gift cards totaling $728 were presented for redemption during the first three months of operation prior to year-end on December 31. The sales tax rate on restaurant sales is 4%, assessed at the time meals (not gift cards) are purchased. Texas Roadhouse will remit sales taxes in January.Required:a. Record (in summary form) the S3,500 in gift cards sold (keeping in mind that, in actuality, the firm would record each sale of a gift card individually). b. Record the S728 in gift cards redeemed. c. Determine the balance in the Deferred Revenue account (remaining liability for gift cards). HEY CAN SOMEONE HELP ME WITH MY LASTEST MATH QUESTION I WILL GIVE BRAINLIST PLEASE :))) The owner of Chips etc. produces two kinds of chips: lime (L) and vinegar (V). He has a limited amount of the three ingredients used to produce these chips available for his next production run: 4800 ounces of salt, 9600 ounces of flour, and 2000 ounces of herbs. A bag of lime chips requires 2 ounces of salt, 6 ounces of flour, and 1 ounce of herbs to produce; while a bag of vinegar chips requires 3 ounces of salt, 8 ounces of flour, and 2 ounces of herbs. Profits for a bag of lime chips are $0.40, and for a bag of vinegar chips $0.50. geometry ^please help me Match the western nations to their coloniesUnited StatesFranceGreat BritainThe Netherlands evaluate 3 + jk + k ^3 when j = 2 and k = 6