How are the hours of darkness linked to the flowering time in plants?

Answers

Answer 1

Answer:

Hope it helps

Explanation:

plants flower as days grow shorter (and nights grow longer) after 21 June in the northern hemisphere, which is during summer or fall. The length of the dark period required to induce flowering differs among species and varieties of a species.


Related Questions

Question What was the ratio of tall to short plants in the F2 generation of Mendel's experiments? A. 3:1 B. 2:1 O C. 1:1 D. 6:1 ​

Answers

Answer:

A

Explanation:

Answer: 3:1

Explanation:

i got it right on the test

Ultra-high-temperature sterilization effectively reduces microbes that cause spoilage. removes only mesophilic microbes. reduces microbes that cause disease. removes all microbes that cause diseases or spoilage. reduces microbes that cause disease or spoilage.

Answers

Answer:

kills all microbes that cause disease or spoilage.

Explanation:

There are different methods of sterilization, such as ultraviolet radiation, autoclave mechanisms, etc.

The sterilization mechanisms eliminate the microorganisms completely, thus generating sterile surfaces.

These mechanisms are used with surgical instruments, the operating room environment.

The autoclave method is the most widely used today due to its economical price, its ease of use and its practicality.

Sterilization methods must be strictly controlled with pilot or test microbiological cultures to be able to corroborate that these mechanisms function correctly, since otherwise they could trigger strong pathologies due to cross contamination.

Which element is being cycled through Earth's system in the image shown
below?
Fossil fuels
Cellular
respiration
Photosynthesis
Animals
Plants
Industry and Home
Death and
decay
A. Oxygen
B. Nitrogen
c. Hydrogen
O D. Carbon

Answers

I took this quiz about 2 weeks ago but I forgot the answer. I think it was Carbon but you shouldn’t trust me till someone confirms it
carbon! hope this helps!!

Metamorphosis is:______.a. changing of one body form to another within a species, such as the change from an aquatic tadpole to a terrestrial frog. b. an intermediate condition, such as length of legs in mice between longer legs of some mice and shorter legs in others, a condition caused by Hox genes. c. the evolutionary transition from fishes to amphibians. d. the developmental changing of a scale to a feather.

Answers

Answer:

changing i think

Explanation:

Why was the Nationalist Party more popular in China’s cities than in the countryside? Wealthy people who supported the party were concentrated in cities. People in the countryside were less active in politics than people in the city. Poor city dwellers hoped the Nationalist Party would bring economic change. The Nationalist Party threatened to end crop trade with Western nations.

Answers

Answer:

Wealthy people who supported the party were concentrated in cities.

Explanation:

Answer:

The answer is A on edge

Explanation:

Which of the following is not a negative consequence of upward urban growth?
a pollution
b creation of a "heat island"
C. increased use of surrounding land
d. waste management issues
Please select the best answer from the choices provided
A
OOOO

Answers

Answer: I believe its C

Explanation:

Answer:

C. increased use of surrounding land

Explanation:

Edge2021

The image shows groundwater zones. Top to bottom: Porous rock or soil, Water, Impermeable rock. Zone 1 is at the top of porous rock. Zone 2 is between porous rock and water. Zone 3 is in the Water. Zone 4 is between the Water and Impermeable rock. Which is the saturated zone?

Answers

Answer:

zone 3

Explanation:

Answer:

C

Explanation:

Write TRUE or FALSE
(a)
A 'system' is the part of an organism that carries out a certain function.​

Answers

Answer:

TRUE

Explanation:

which best describes bacterium?

Answers

Answer:

Bacteria (singular: bacterium) are classified as prokaryotes, which are single-celled organisms with a simple internal structure that lacks a nucleus, and contains DNA that either floats freely in a twisted, thread-like mass called the nucleoid, or in separate, circular pieces called plasmids. Hope this helps :))

Explanation:

Answer:

Bacteria are classified as prokaryotes, which are single-celled organisms with a simple internal structure that lacks a nucleus, and contains DNA that either floats freely in a twisted, thread-like mass called the nucleoid, or in separate, circular pieces called plasmids.

Explanation:

Only ------ percent of the food eaten is turned into its own body. *



20%

12%

10%

40%​

Answers

Answer:

12% I think this is right answer v

guy plz chat with me

Answer:

the answer is 10%

Explanation:

the 10% rule states that only 10% of energy is passed from one trophic level to the other (organism to organism)

Metals are useful in industry because they can be shaped without breaking. What is this property of metals called?

Answers

Answer:

malleable ................

Answer:

versatility ductility conductivity malleability

What is another name of molecular biology????

Answers

Answer:

biotechnology

Explanation:

hope it help you

Answer:

biotechnology biotech

biological engineering biological science

How are the proteins inside your body affected by the presence of water and other molecules?

Answers

Answer:

Our body is constitute of several essential molecules such as proteins, fat, carbohydrate, water, and other molecules.

Each molecule has some of the impact of other molecules in the body. Impact of water and other molecules on proteins inside the body are as follows:

Proteins have ligand-binding site and water provide stability to the ligand-binding site of proteins through its hydrogen bonds.Conformational flexibility and transitions of proteins are due to the presence of water molecules in it.Disbalance in the pH of body due to changing concentration of sodium-potassium ions can denature the protein. Enzymes present in the body can control the rate of formation of proteins in the body.

what are sex hormones?why are they named so? state their function.

Answers

Answer:

Sex hormones or hormones of the reproductive organs are certain cells in the reproductive organs that produce hormones.

The testis produces testosterone,the male sex hormone,and the ovaries produces oestrogen and progesterone, the female sex hormones.

In a sexually mature male,testosterone influences sexual behaviour, and together with FSH,regulates sperm production in the seminiferous tubules of the testes.

Sexually matured females undergo a regular 4-week reproductive or menstrual cycle during which a mature egg is released.This cycle is regulated by oestrogen and progesterone. During pregnancy, progesterone inhibits egg production (ovulation),brings about the development of the placenta and prevents the uterus from contracting....I hope this answers your question... Thank you for the question.

The hypothalamic hormone that triggers the secretion of FSH and LH from the anterior pituitary is

Answers

Answer:

Hypothalamic-Pituitary-Gonadal Axis

GnRH produced by the hypothalamus stimulates the production of both LH and FSH. FSH functions by stimulating ovarian follicular development in females and regulating spermatogenesis in males. LH induces ovulation and corpus luteum formation in the ovaries.

plz give brainlist

hope this helped

The process whereby the earth’s life changes over time through changes in genes of populations of organisms in succeeding generations is called____.a. emigration.b. mutation.c. natural selection.d. evolution.e. genetic drift.

Answers

Answer:

The correct answer is option : d. evolution.

Explanation:

Change in the heritable traits or characteristics of population of a organism over time by the adaption or changes in genes of such population over successive generation is known as the evolution.

These changes that cause the evolution of the biological population is caused by the process of adaption through natural selection that is the ability of the passing beneficial genes from parent to offspring.

Thus, the correct answer is option D. evolution.

what type of cash crops have been genetically modified..... please help!!!!!

Answers

Answer:

Most food modifications have primarily focused on cash crops in high demand by farmers such as soybean, corn, canola, and cotton. Genetically modified crops have been engineered for resistance to pathogens and herbicides and for better nutrient profiles.

Explanation:

While performing an experiment, it is important to:
a. change the control setup
b. test many different variables at the same time
c. reach a conclusion
d. record observations and measurements

Answers

Answer:

D

Explanation:

While performing an experiment, it is important to record observations and measurements, as in Option d. Option d is correct regarding the facts of the experiments, while the others are wrong.

What is an experiment?

The experiment is carried out to observe the hypothesis, and in this process, a control set-up is taken whose value or result is already known, and the variables are taken and compared with the control. The controls set should never change in the experiment because the variables are tested with reference to them, and the measurements and observations of the experiment should be taken into consideration to prove the hypothesis. All the variables should not be tested at once because if this is done, it would introduce error into the experiment, and not all the experiments are done to get the conclusion.

Hence, while performing an experiment, it is important to record observations and measurements, as in Option d.

Learn more about the experiment here.

https://brainly.com/question/11256472

#SPJ2

I have four brothers
"This is what type of
observation?

Answers

Quantatative data since it is physically counting

SIOM CSserials
What has a greater influence on protein levels?
(1 point)
Protein degradation has a greater influence because outside factors like antibiotics can
cause it, and it is difficult to recover from.
O
Protein degradation has a greater influence because they are denatured faster than the cell
can produce them.
mRNA destroyer concentration has a greater influence because it is destroying mRNA before
proteins can even be produced.
mRNA destroyer concentration has a greater influence because mRNA is destroyed right
after the proteins are produced.

Answers

Answer:

mRNA destroyer concentration has a greater influence because it is destroying mRNA before  proteins can even be produced.

Explanation:

Proteins are synthesized from mRNA through the process of translation. mRNAs are first synthesized from a coding DNA template through the process of transcription. Hence, if mRNAs are destroyed, it means proteins will not be synthesized at all.

Protein not being synthesized at all means that mRNA destroyer concentration has a greater influence on protein levels than protein degradation. With protein degradation, not all the protein is degraded at once and some quantity of the protein can still be found, but with mRNA destroyer concentration, no protein can be found at all because it was not synthesized in the first place.

How much time is required for a P-wave to travel 6,000 kilometers?

Answers

Answer:

294.1 minutes

Explanation:

5,882 seconds (98 minutes) to travel 2,000 km.

2,000 x 3 = 6,000

5,882 seconds x 3 = 17,646

(294.1 minutes) to travel 6,000 km

Please I need help with this

Answers

TAAGCCGATAAATGCTAACGGTA

a pupil performed an experiment in a school lab to show the action of a digestive enzyme on a food substance

a) Name and enzyme suitable for such an experiment
b) Name a food substance on which the enzyme that you have named will act
c) Describe any preparation of the food required before the experiment is performed. If no preparation is required state why?
d) give the temperature at which the enzyme-food mix should be maintained for the experiment to work
e) how much time is needed for digestion of food in this experiment?
f) describe a test to confirm that digestion has occurred ​

Answers

I prefer d as the correct answer!!!

Why is environmental science important?

Answers

Explanation:

it is where we live and share resources with order species

I hope this was helpful

Proteins in the cell membrane have many functions. Which type of protein would be used for cell recognition and as a receptor? A. Pore proteins B. Endoplasmic proteins C. Glycoproteins D. Integral proteins

Answers

Answer:

C. glycoproteins

Explanation:

Glycoproteins are proteins containing glycans (oligosaccharide carbohydrates) attached to amino acid side chains. These oligosaccharides are attached to the amino acid chain by a posttranslational modification referred to as glycosylation, a modification generally found in extracellular regions. Glycosylation refers to the chemical reaction in which a glycosyl donor (i.e., the carbohydrate) is attached to a functional group in the protein. The glycosylation sites play distinct functional roles for both cell interactions and cell recognition. Moreover, glycosylation sites are also essential for substrate recognition by an enzyme. For example, secreted cytokines are glycosylated, which is required for their binding to receptors.

Which of the following is a distinct structure found specifically in the liver, spleen, and bone marrow?
Select one:
a. Sinusoidal capillaries
b. Fenestrated capillaries
c. Venous sinus
d. AV anastomoses
e. Continuous capillaries​

Answers

Answer:

option A is correct

Explanation:

2. How are each of the following groups likely to feel about the reintroduction of wolves in Yellowstone National Park? (write 2-3 sentences for each)

a. Tourists who visit the park

b. Environmentalists (people who want to protect the nature of Yellowstone)

c. People who live near the park

Answers

Answer:

a) Good

b) Good

c) Bad

Explanation:

Tourists who visit the park feels good about the reintroduction of wolves in the park because it is a new animal they are seeing in the park. Environmentalists also feels good because this action is a step towards the protection of organisms present in the nature. People who live near the park does not feel good because wolf is a dangerous animal and if he escaped from the park, the lives of the people will be in danger.

steps of Biological method of study taking malaria as an examples

Answers

Explanation:

The different steps which are involved in biological method are the the invasion, the rapid division followed by the spread of infection. ... Malaria results in infection after the bite of the female anopheles mosquito. The parasites enter the bloodstream. as a result of this there is predominant infection.

How are the molecules in photosynthesis and cellular respiration similar? Please include descriptions of the molecules

Answers

Answer:

They are similar because they both produce energy but in two different forms.

Photosynthesis- It produces oxygen and G3P, simple carbohydrate molecules that are high in energy and can be converted into glucose, sucrose, or other sugar molecules.

cellular respiration-During cellular respiration, a glucose molecule is gradually broken down into carbon dioxide and water.

They exhibit the same responses, but they do so in reverse. Carbon dioxide and water are converted during photosynthesis into glucose and oxygen. Carbon dioxide and water are produced during respiration in exchange for glucose and oxygen.

What similarity in photosynthesis and cellular respiration?

Energy transformations from one form to another are a part of both respiration and photosynthesis through a sequence of metabolic reactions.

The reactions that are carried out by both processes—which both use and produce ATP—are carried out on membranes and are managed by enzymes.

Light energy is converted by photosynthesis into chemical energy that is stored in glucose, which is then released by cellular respiration to create ATP, the life-sustaining compound.

Therefore, They are similar because they both produce energy, but in two different forms.

Learn more about cellular respiration here:

https://brainly.com/question/28532054

#SPJ2

Muscle cell are richer in lysosomes , as they require lot of energy. correct and rewrite the following statement.

Answers

Answer:

See below

Explanation:

The correct statement is:

=> Muscle cells are richer in mitochondria, as they required lots of energy.

Mitochondrion acts as power house of the cell providing the cell with the required energy.

Correct Statement:-

Muscle cells are richer in Mitochondria, as they require a lot of energy.

[tex] \large{ \underline{ \boxed{ \pink{ \rm{Explanation}}}}}[/tex]

Especially in Skeletal muscles, Mitochondria and glycogen granules are found in abundance. Our limbs that includes our arms and legs shows movement which needs energy. The food is oxidized and energy is released.

More to know:-Mitochondria is popularly known as Power house of the cell or ATP generation site.It is a double-membranous structure with outer membrane smooth and inner membrane surrounds the matrix.The inner membrane have cristae which increase surface area.The cristae bear Oxysomes or F0-F1 particles.Mitocondria is semi-autonomous, it have it's own DNA and ribosomes.

━━━━━━━━━━━━━━━━━━━━

Other Questions
Think of an ethical question that might arise in your own life. What are two possible answers to the question? Which answer do you think is better? Expectant mothers many times see their unborn child for the first time during an ultrasonic examination. In ultrasonic imaging, the blood flow and heartbeat of the child can be measured using an echolocation technique similar to that used by bats. For the purposes of these questions, please use 1500 m/s as the speed of sound in tissue. I need help with part B and C To clearly see an image, the wavelength used must be at most 1/4 of the size of the object that is to be imaged. What frequency is needed to image a fetus at 8 weeks of gestation that is 1.6 cm long? A. 380 kHz B. 3.8 kHz C. 85 kHz D. 3.8 MHz If the rate of formation (also called rate of production) of compound C is 2M/s in the reaction A --->2C, what is the rate of consumption of A Using the function f(x)=-x^2+8x-13 find f(4) SOMEBODY PLS HALP ;( According to the number line, which statement MUST be true? A) A > 1 B) B > 4 C) C < 4 D) D < 0 What is the product of the reaction of pentanoic acid with ethanol in the presence of a strong acid? Maria is buying new carpet for her bedroom .Her bedroom is in the shape of a square and the length of each side is 12 feet write and simplify an exponential express to find how much carpet she needs. Help someone please!! Kitty buys hot chocolate sachets. There are 14 hot chocolate sachets in a small box. A small box costs 3.49. Kitty uses 3 hot chocolate sachets each day. Work out the how much Kitty spends on hot chocolate sachets in a four-week period. Erica can run 1 / 6 fraction of a kilometer in a minute. Her school is 3 / 4 of a kilometer away from her home. At this speed, how long would it take Erica to run home from school? answer quick plz A middle school has 470 students. Regina surveys a random sample of 40 students and finds that 28 have cell phones. How many students at the school are likely to have cell phones? A. 132 students B. 188 students C. 329 students D. 338 students Please include ALL work! Calculate the density of the following material.1 kg helium with a volume of 5.587 m700 kg/m5.587 kg/m0.179 kg/m The last dividend paid by Coppard Inc. was $1.25. The dividend growth rate is expected to be constant at 27.5% for 3 years, after which dividends are expected to grow at a rate of 6% forever. If the firm's required return (rs) is 11%, what is its current stock price Which of the following is not an antioxidant _________1) Sodium benzoate 2) Sulphur dioxide 3) Sulphite salts 4) Citric acid What is the the product of (-1 - 3i) and its conjugate? The data represents the daily rainfall (in inches) for one month. Construct a frequency distribution beginning with a lower class limit of and use a class width of . Does the frequency distribution appear to be roughly a normal distribution? Can somebody please solve this problem for me! Type equal, supplementary, complementary, or vertical in the space provided Find two positive fractions that subtract to 1/6. Write your answer as fraction -fraction write the fraction for each of the following do number 3 and 4 thanks