How did herd behavior play out in "The Momsters Are Due on maple street"

Answers

Answer 1

Answer:

Herd behavior is ingrained in the mass mindset. The masses are destined/almost doomed to lose because they refuse to accept a straightforward factoid; fear pays poorly. And because they refuse this simple fact, they are doomed to repeat the mistakes of the past with perfect precision.

Explanation:


Related Questions

Name at least three POSITIVE things in Esperanza’s life.

Answers

Answer:

She is responsible and takes care of the people in her community.

She is gifted in the ability of writing.

She helps neighborhood women.

Explanation:

PLZZZ ANSWER QUICK !!

Read the excerpt from "Homesick."
I was looking up at a white cloud skittering across the sky when all at once someone tramped down hard on my right foot. Ian Forbes
Snarling bulldog face.
What does the figurative language in the excerpt tell readers about lan Forbes?
Olan is very unattractive
O He feels threatened by the narrator.
O lan is seeking attention.
O He wants to scare the narrator.

Answers

Answer:

he wants to scare the narrator

Explanation:

The figurative language the readers about lan Forbes is :

D) He wants to scare the narrator.

"Homesick"

The figurative language the readers about lan Forbes is that he wants to scare the narrator.

Figurative language is a way of communicating oneself that does not utilize a word's strict or practical meaning.

Common in comparisons and embellishments, it's as a rule utilized to include imaginative thrive to composed or talked dialect or clarify a complicated idea.

Thus, the correct answer is D.

Learn more about "Homesick":

https://brainly.com/question/2400770?referrer=searchResults

Describe the difference between the summer and winter solstice.

Answers

Answer:

The summer solstice is on June 21st and is the longest day of the year. The winter solstice is on December 21st and is the longest night of the year.

Explanation:

5.3. He left in a hurry after he got a phone call
, but
he came back five minutes later.
(2 Points)
simple
compound
complex
compound-complex

Answers

Compound sentence is the answer

The sentence "He left in a hurry after he got a phone call, but he came back five minutes later" is a compound-complex sentence.

A compound-complex sentence has, at least, two independent clauses and one dependent clause.

An independent clause has a subject and a predicate. It conveys a full thought and can stand alone as a sentence.

One of the two independent clauses in a compound-complex sentence will be introduced by a coordinating conjunction - but, for, and, nor, or, yet, so.

A dependent clause is introduced by a subordinating conjunction - after, because, etc.. It also has a subject and a predicate, but it cannot stand alone as a sentence.

We can break down the sentence we are analyzing here in the following manner:

1. Independent clause: "He left in a hurry"

2. Dependent clause: "after he got a phone call"

3. Independent clause: "but he came back five minutes later."

Learn more about the topic here:

https://brainly.com/question/9405721

the main idea of the fish I didn't catch

Answers

The meaning of the word trifles helps us to understand the little value grow up people give to the feelings of children. Its meaning get clearer when seeing the comparison to the importance is given to the feelings of grow up people. Although, In the Fish I didn’t Catch, written by John Greenleaf Whittier in 1843, the tone seems different. The narrator regrets that fact of not giving much importance to the feelings of children, because when adults pay attention to them children grow more aware of the world and how things really happen. That is the precise meaning of the Fish I didn’t Catch, that lesson taught him since he was a kid, not to boast before something is done. He thanked his uncle for paying attention to his feelings because that helped him grow.

15. What is this encyclopedia entry mainly about?
While Neil Armstrong may forever have the distinction of being the first man to walk on the moon, he wasn't the first man to walk in space. In fact, the first person to walk in space wasn't American. That distinction belongs to Russian Alexei Leonov. He flew into space in 1965 boarding the Voskhod 2 spacecraft. Like Armstrong, Leonov also had a partner to share in this accomplishment as Leonov was joined by cosmonaut Pavel Belyayev. Leonov exited the Voskhod's hatch and took the first steps into space. He wore a backpack containing air, similar to the pack worn by scuba divers. His 12-minute walk was the first of its kind. The fact that the walk looked more like he floated did not take away from this accomplishment. Three months later, the U.S. played catch-up and sent astronaut Edward White aboard the Gemini to walk in space.
15. What is this encyclopedia entry mainly about?

a. Alexei Leonov graduated from the Soviet air force flying and engineering schools.
b. During the 1960s, the American space program tried to catch up to the Russians.
c. American Edward White was the second human to walk in space in 1965.
d. Russian Alexei Leonov was the first human to walk in space in 1965.

Answers

Answer: D

Explanation:

plss help
rhyming scheme of the poem given below

Answers

Answer:

The rhyming scheme of the poem is:

ABAB CDCD EFEF

Explanation:

To find the rhyme scheme of a poem, we must pay attention to the final sound of the last word in each line. The very first final sound is always given the letter A as an identifier. Every time that sound is repeated in the last word of a line, it will be identified as A. The second final sound will be B, the third, C, the fourth D, and so on. Let's do that for the poem we are analyzing here. Since our focus is the last word of each line, let's omit the rest:

soaring A

breeze B

roaring A

seas B

glancing C

high D

dancing C

sky D

lashing E

spray F

dashing E

to-day F

Words to know
Fill in this table as you work through the lesson. You may also use the glossary to
help you.
analysis
a careful
characterization
the way a character is
conflict
a
between two forces
nuity, Inc.

Answers

Answer:

Analysis- A careful examination.

Characterization- The way a character is represented.

Conflict- A struggle between two forces.

Explanation:

The three words above are literary terms. A literary analysis is a careful examination of the composition of a work of literature and the hidden meanings in it.

Characterization is the representation of characters and might be direct or indirect. Direct characterizations reveals the personality of the character through a description of his physical features, his desires, career, etc. Indirect characterization reveals the personality of the character through his thoughts, speech, and actions.

A conflict is a struggle between two forces. It could be internal or external.

Answer:

Analysis- A careful examination.

Characterization- The way a character is represented.

Conflict- A struggle between two forces.

Explanation:

\\\\\\\\\⠀⠀⠀⠀⠀⠀ ⠀⣠⣴⣶⣿⣿⣷⣶⣄⣀⣀⠀⠀⠀⠀⠀⠀⠀⠀⠀
⠀⠀⠀⠀⠀⠀⠀⠀⠀⣰⣾⣿⣿⡿⢿⣿⣿⣿⣿⣿⣿⣿⣷⣦⡀⠀⠀⠀⠀⠀
⠀⠀⠀⠀⠀⠀⠀⢀⣾⣿⣿⡟⠁⣰⣿⣿⣿⡿⠿⠻⠿⣿⣿⣿⣿⣧⠀⠀⠀⠀
⠀⠀⠀⠀⠀⠀⠀⣾⣿⣿⠏⠀⣴⣿⣿⣿⠉⠀⠀⠀⠀⠀⠈⢻⣿⣿⣇⠀⠀⠀
⠀⠀⠀⠀⢀⣠⣼⣿⣿⡏⠀⢠⣿⣿⣿⠇⠀| O⠀⠀O⠀|⠈⣿⣿⣿⡀⠀⠀
⠀⠀⠀⣰⣿⣿⣿⣿⣿⡇⠀⢸⣿⣿⣿⡀⠀\______/⠀⣿⣿⣿⡇⠀⠀
⠀⠀⢰⣿⣿⡿⣿⣿⣿⡇⠀⠘⣿⣿⣿⣧⠀⠀⠀⠀⠀⠀⢀⣸⣿⣿⣿⠁⠀⠀
⠀⠀⣿⣿⣿⠁⣿⣿⣿⡇⠀⠀⠻⣿⣿⣿⣷⣶⣶⣶⣶⣶⣿⣿⣿⣿⠃⠀⠀⠀
⠀⢰⣿⣿⡇⠀⣿⣿⣿⠀⠀⠀⠀⠈⠻⣿⣿⣿⣿⣿⣿⣿⣿⣿⠟⠁⠀⠀⠀⠀
⠀⢸⣿⣿⡇⠀⣿⣿⣿⠀⠀⠀⠀⠀⠀⠀⠉⠛⠛⠛⠉⢉⣿⣿⠀⠀⠀⠀⠀⠀
⠀⢸⣿⣿⣇⠀⣿⣿⣿⠀⠀|⠀⠀⠀⢀⣤⣤⣤⡀⠀⠀⢸⣿⣿⣿⣷⣦⠀⠀⠀
⠀⠀⢻⣿⣿⣶⣿⣿⣿⠀⠀\__⠀⠈⠻⣿⣿⣿⣦⡀⠀⠉⠉⠻⣿⣿⡇⠀⠀
⠀⠀⠀⠛⠿⣿⣿⣿⣿⣷⣤⡀⠀⠀⠀⠀⠈⠹⣿⣿⣇⣀⠀⣠⣾⣿⣿⡇⠀⠀
⠀⠀⠀⠀⠀⠀⠀⠹⣿⣿⣿⣿⣦⣤⣤⣤⣤⣾⣿⣿⣿⣿⣿⣿⣿⣿⡟

Answers

Answer:

*All hail the king/Queen*

Which of the following would be considered an extended metaphor in The
Grapes of Wrath?
A. The reference to the owners in both the plot and intercalary
B. The reference to a developing vintage at the end of intercalary
C.The use of the name "Rose of Sharon to allude to the Bible
OD. The use of intercalary chapters to give a generalized picture of
chapters
chapters
events in the time period

Answers

The answer is B. The reference to a developing vintage at the end of intercalary

Answer:

B. The reference to a developing vintage at the end of intercalary chapters

Read The Ones Who Walked Away from Omelas and answer these questions

The people of Omelas were preparing for ___. *
a) The winter solace
b) The Autumn Moon
c) The Festival of Summer
d) Exposure of the child

2) Which word best describes the type of government that governs Omelas? *
a) Monarchy
b) Totalitarianism
c) Anarchy
d) None of the above

3) According to the text, the people of Omelas can be described as all of the following EXCEPT *
a) Mature
b) Passionate
c) Simple
d) Intelligent

4) The setting of “The Ones Who Walk Away From Omelas” is *
a) In the mountains, current time
b) Omelas, Summer Festival
c) In the desert, future
d) Another planet, future

5) Omelas is an anagram for *
a) New York, New York
b) Salem, Oregon
c) Lancaster, Pennsylvania
d) Miami, Florida

6) In the beginning of the story, the beautiful city of Omelas that Le Guin describes could be considered a Utopian community; however, as the reader continues to read, they learn that this society contains all of the following except a *
a) Flaw
b) Blessing
c) Defect
d) Imperfection

7) According to the author, what is the “incredible” aspect of Omelas? After seeing the child sometimes … *
a) “The people speak a kind word to the child”
b) “The people begin to instill laws”
c) “They leave Omelas, they walk ahead into the darkness, and they do not come back. The place they go towards is a place even less imaginable to most of us than the city of happiness”
d) “They feel disgust, which they had thought themselves superior to”

8) The terms in Omelas are *
a) “irrational”
b) ”strict and absolute”
c) “unknown and confusing”
d) “barbaric and unforgiving”

9) The child in the basement can symbolize all of the following except *
a) Isolation
b) Sacrifice
c) Eternity
d) Scapegoat

10) The mood/tone of the text in the beginning of the story can be described as _____. The mood changes after the child in the cellar in introduced to the reader. Le Guin’s description of the child creates a sense of __________. *
a) Joyful; blissfulness
b) Blissful; misery
c) Anguish; depression
d) Felicity; affection

11) All of the following sentences are evidence of the mood/tone developed in the beginning of Omelas EXCEPT *
a) “The music beat faster, a shimmering gong and tambourine, and the people went dancing ..."
b) “Perhaps it was born defective, or perhaps it has become imbecile …”
c) “The rigging of the boats in harbor sparkled with flags.”
d) “Their manes were braided with streamers of silver, gold, and green.”

12) Which statement is undoubtedly true? *
a) The child in the cellar is a young girl
b) The child in the cellar is a young boy
c) The child can remember sunlight and its mother’s voice
d) The child has been placed in the basement because it is defective

13) Where do the people go when they leave Omelas? *
a) To another town
b) To the police station
c) To the homes of the families that they left behind
d) It is unknown

14) Why has the child been placed in the cellar? *
a) It was born defective and therefore must be kept away from the rest of the people in Omelas
b) It is an imbecile and therefore cannot participate with the rest of the community
c) The happiness of the people in Omelas depends solely on the child’s misery
d) It is being punished for not participating in the Summer Festival

15) Which SET of words BEST describes the living conditions of the child in the cellar? *
a) Sanitary, organized, and tidy
b) Unsanitary, organized, and filled with nutritious meals
c) Unsanitary, neglectful, unhealthy
d) Unsanitary, unpolluted, thriving

16) Which of the following is TRUE about the city of Omelas? *
a) They had slaves
b) They were noble savages
c) They were less complex than others
d) They did not use swords

17) According to Le Guin, happiness is based ___. *
a) On the dependence on technology
b) On the ability to create great art
c) On comfort of luxury
d) On a just discrimination of what is necessary

18) Which statement best describes the paradox present in the story? *
a) The people of Omelas are happy and preparing for the Festival of Summer
b) Some people walk away from Omelas
c) A city that appears to be a Utopia filled with joy has a dark secret (their happiness depends the ultimate misery of an innocent child)
d) The narrator is unreliable

19) What type of conflict exists in Omelas? *
a) Internal
b) External
c) Man vs. self
d) All of the above
Submit

Answers

Answer:

c

Explanation:

Netflix recommendations??

Answers

Answer:

The Hollow and Flash

Explanation:

Answer:

What Kind of shows do you like?

Explanation:

If it's anime, I recommend Promised Neverland, Haikyu!!, or Seven Deadly Sins. And Hunter X Hunter.

If it's normal shows, I recommend The Good Place, Riverdale, or The Office.

Movie wise, I recommend The Half Of It, The Perks Of Being A Wallflower, Sierra Burgess Is A Loser, and The Kissing Booth, both 1 and 2.

"When he slammed his book-bag on the ground, the boy's iPad screen broke." Is this a simple or compound sentence?

Answers

Answer: this is a compound sentence

Explanation:

There is 2 predicates being talked about, the book bag and the tablet screen and subjects being talked about, the. Since a compound sentence has 2 subjects and 2 predicates, it is a compound sentence.

Write a one or two paragraph summary from the article "Body Language and Gestures" using text evidence to support your writing.

please do not use me its a test and my parents said that if i do not pass the im gonna get a spanken

Answers

Answer and Explanation:

The human being is the only animal that manages to communicate through verbal communication, through the levers, and, through non-verbal communication, where body language is used, through gestures and positions.

This enriches the communication between human beings, leaving it with diversified, complete and even more inclusive, since many people have difficulties with verbal communication. In addition, body language is able to convey the speaker's feelings, which is expressed more intensely through the body.

Sarah doesn't have a (bias/biased) against sports but he doesn't enjoy playing them?

Answers

Answer: Sarah doesn't have a bias against sports but he doesn't enjoy playing them?

Explanation:

(wait, I mean no offence to them, but is Sarah a boy or a girl? it says 'he'. Not judging)

Doing homework has been proven to increase grade point average. This statement is an example of the ___ appeal.

Answers

Answer:

Smart? this question confusing

Explanation:

How does this document advocate for the rights of children? Why is this important to understand? The questions is from the "declaration of the rights of the child"

Answers

Answer:

1. Latin.

2. 1600.

3. Italicus.

Explanation:

The declaration of rights of children shows that the children need to be protected and Welfare and this declaration states the right regarding the same.

What is a declaration of rights?

In accordance with the Declaration, there was various right that was being advocated with regard to students. Some of them are everyone owes children the entitlement to financial stability, security against manipulation, tools for their growth, special assistance in situations of need, as well as nurture that fosters social responsibility.

This was necessary to establish their childhood, they can have a great future. So child children or teenagers are the building blocks for the nation they are to be natural in the near future.

This offer fundamental freedom that the children should also have. It was also to give them protection and have their physical, mental, and social enlistment.

Learn more about declaration of rights, here:

https://brainly.com/question/19787151

#SPJ2

When reading the "Yes Virginia, There is a Santa Clause" piece, how can you use your voice to show the emotion the
writer wants to express?
a. pause when necessary
C. speak clearly
b use expression
d. all of the above

Answers

Answer:

d

Explanation:

these will all help u show emotion .

It’s D....................

PLZ HELP ME!!!!!!!!!!!!!!

Answers

Answer:

Blood and violence

Explanation:

I hope this helps:))

What is the correct meaning of the word fainter?
The light grew fainter with each passing hour.
less faint
most faint
not faint
more faint

Answers

Answer:

more faint

Explanation:

the light is getting less bright with each passing hour

According to neighborhood legend, what terrible things did Boo and his gang do?
What did they do one night to get in trouble with the law?

Answers

Answer:

They escaped and hid in a Trunk

Describe your most significant experience with nature. Try to remember the
sights, sounds, smells and other sensory details of the experience. Did it have
a positive or negative effect on your relationship with the natural world? Did
the experience change you as a person?

Answers

Answer: I remeber going on a trip one year and it was amazing. It was with one of m favorite teacher. We saw tiny ants crawling with huge leaves on their backs. And the sap from the trees trickling down, as the woodpecker's chip of the wood bark.  The sound of faint birds in the background and the strong wind gushing by us. It was an amazing trip. I can say that it has made me see the word as beautiful and not take for granited what we have.

Explanation:


Which phrase accurately defines the term narrative

Answers

Answer:

No one can really answer this question,

Explanation:

mostly because you didn't put down the phrases.

Whats the answer????

Answers

Answer:

a.first choice

Explanation:

educated guess

Help me
It's like the walls are caving in
sometimes I feel like giving up
No medicine is strong enough
Someone help me
I'm crawling in my skin

I'm so tired and bored and I took an exam today
And I have an exams tomorrow
And next week all the days too

Answers

Explanation:

you should study....

I just don't want you to fail!

Answer:

Hi, wanna be friends?

Explanation:

I can cheer you up and cure your boredom (or at least I'll try )

Ik how you feel anyway...

Please, help me with answers if u know anything ❤️

Answers

Answer: can someone also help me with  mine cause its do today thx!

Explanation:

should students have sports in high-school?


make an introduction paragraph

Answers

Answer:

yes

Explanation:

I have a dream main Idea of paragraph 3

Answers

Answer:

More info, please.

Answer:

woWO

Explanation:

fbffb`

`ufbh

Is it startled or startling??​

Answers

Answer:

Startling

Explanation:

Startled doesn't make any sense in this sentence

Hope this helps. Have a nice day you amazing bean child.

Grandpa Bill grabbed a cue from the rack.
a. a ball used to play pool
b. a stick used to play pool
c. a storage container for pool equipment

Answers

Answer:

A.)

Explanation:

It is describing a cue ball

Answer:

The answer would be B.) a stick used to play pool.

Explanation:

Therefor the choices A.) and C.) are wrong.

Fun Fact about the cue:

The word "cue" is derived from the French queue, meaning tail. Before the cue stick was designed, billiards was played with a mace. The mace consisted of a curved wooden (or metal) head used to push the ball forward, attached to a narrow handle.

Hope You have a nice day : )

Other Questions
Creative block! I WILL GIVE BRAINLIEST AND 5 STARS.... PLEASE HELP!!! using all my points for this!!!either give me a topic idea or the full essay it can be 240 words or something too my teacher will accept that. It is just for a lesson question so no pressure if it is 200 words or less I can work on it and add more words I just need a skeleton essay because I am having writers block."Select an environmental issue faced by the countries of this region. Write an essay of 300 words describing the problems presented by your chosen issue and possible solutions to the problem." A store is having a 20%-off sale on its video games. What is the amount of the discount on a game that regularly costs $25? What are the like terms in the expression: 2a + 3b+ 4C - 5a + 8 - 4THESE ARE THE OPTIONS 2,3,4, -5O 2a, 3b, 4c-5a, 82a, -5a, 8, -4HELPP What is the mRNA and Amino Acids for: TACACCTTGGCGACGACT What caused the original creation of the Universe? How do we find out? A duck walked up to a lemonade stand and he said to the man running the stand: Create a flow chart that shows the hierarchy of the US Banking Systems. which is the correct graph for the equation? TACTTAGAGGCACCACATGGGCCTTGCACT to mRNA Bryan wants to buy a new pair of jeans. If the jeans were originally $45.00, but are on sale with a 20% discount, how much will Bryan have to pay for the jeans? MR. ARCEO TAKES A TAXI FROM THE AIRPORT TO A HOTEL. THE TAXI CHARGES $2.50 INITIAL CHARGE PLUS $2.65 PER MILE. WHICH EQUATION CAN BE USED TO FIND Y, THE TOTAL COST OF THE TRIP, IF X REPRESENTS THE NUMBER OF MILES OF THE TRIP? Please help with this Spanish work. The topic is Superlatives. THIS IS FOR DANCE IT IS STILL MY CLASS THERE IS JUST NO OPTION FOR ITWhat are some stretches you can do to increase flexibility in your legs? One-third of Olivia age , increased by 12 , is equal to twice her age , decrease by 3. How old is Olivia What is greater -3.2 or -3 2 MATH K.Parker is trying to solve the addition problem below.58 +36 =Drag and drop the numbers below to complete each sentence.Is and PlaceParker will need to change!ones intoten andones. The answer to the addition probleman and1000is 58 +36 =945 - Part 12.: 3:: 5:: 13:: 14:: 15! 84s - Part 2Next2 of 13Copyright 2020 Edmentum, Inc. All Rights ReservedPrivacy Policy California Privacy Rights Contact10:3 List two equivalent numbers to 0.50 Lydia made 3 pounds of trail mix. One portion of trail mix is 19 pound. How many portions of trail mix did Lydia make? You know I never approved of it, pursued Utterson, ruthlessly disregarding the fresh topic.My will? Yes, certainly, I know that, said the doctor, a trifle sharply. You have told me so.Well, I tell you so again, continued the lawyer. I have been learning something of young Hyde.The large handsome face of Dr. Jekyll grew pale to the very lips, and there came a blackness about his eyes. I do not care to hear more, said he. This is a matter I thought we had agreed to drop.The Strange Case of Dr. Jekyll and Mr. Hyde,Robert Louis StevensonWhere in the plot is this passage found?the expositionthe rising actionthe falling actionthe resolution 1. (04.04 HC)Lee y escoge la mejor respuesta. Read and select the best answer.Hoy en da, hay muchos estudiantes que estn perdiendo algo muy importante y profundo en su educacin. Esta es la presencia de la msica y el arte en las escuelas. El estudio del arteayuda a enriquecer a los estudiantes y exponerlos a otras culturas y perspectivas. Estas experiencias ayudan a prepararlos para el futuro. Deberamos gastar ms dinero en el arte y no soloen las ciencias y las matemticas.(1 point)Segn la lectura, que podra ser un gancho para esta lectura? Un gancho para esta lectura podria serO el arte no debera estar en la escuelaO qu es el arte para ti?O cul es el valor de una educacin artstica?O solamente las ciencias y las matemticas