how did space exploration affect the cold war during the 70's

Answers

Answer 1

Explanation:

The U.S. and the Soviet Union were in a space race to develop technology to land on the moon 1st. By the time, that John Kennedy declared his plans, in the early 1960’s, to put a man on the moon by the end of the decade; the US was far behind the USSR in space technology. But from a historical perspective, John Kennedy was completely uninterested in space. His reasoning was that the US “had” to strike the USSR to the moon. As the people of the US became responsive that the USSR was out pacing them in technology, which they’d quite well believed that the US was greater in up until that point, sustain for a fully funded space program began to grow quickly. This permitted the support required for the Kennedy and Johnson administrations to virtually give NASA a clean check to fund the space program. Thus making U.S. landed Louis Armstrong on the moon 1st a day earlier.


Related Questions

Describe the basic population and social structure of the 18th century colonies and indicate how they had changed since the 17th century. 2 Paragraph minnimum

Answers

Answer:

The population and social structure of the 18th and 17th century differ from one another for several reasons.

Explanation:

In the beginning, the purpose of establishing colonies in the New World was economic reasons. Settlers who settled in new colonies were living in harsh condition, and the population remain low. Slowly settlers from England began to arrive to escape prosecution because of religious practices. The tobacco-growing led in the emergence of the white indentured servants in colonies. Life was harsh, so servants required to reduce the burden from the settlers. White indentured servants became common during the early settlement.

During the 18th century, there was a sharp rise in the population in colonies accompanied by dependence on slave labour. There was an increased mingling of different races. People from Africa shipped in American colonies as labours and servants. The South became dependence on slaves as they were part of the plantation society. Poeple from Europe also arrive to escape poverty, debt, and wanted to start a new life from a beginning.

What is archaeology? the creation of maps using complex series of data the scientific study of artifacts from past human life the use of historical documents to create a narrative the location of tools and pottery using satellite imagery

Answers

Hey there! I'm happy to help!

Archaeology is the studying of ancient human civilization via artifacts, remains, etc. If somebody visits Machu Picchu and they analyze the structures there to find more about the Incas who lived there, that person is an archaeologist.

So, your answer is the scientific study of artifacts from past human life.

Have a wonderful day! :D

Answer:

Explanation:

Archaeology is the studying of ancient human civilization via artifacts, remains, etc. If somebody visits Machu Picchu and they analyze the structures there to find more about the Incas who lived there, that person is an archaeologist.

So, your answer is the scientific study of artifacts from past human life.

Columbus first landed at:

Hispaniola
Cuba
Jamaica
San Salvador

Answers

Explanation:

San Salvador, which is now called the Bahamas.

Answer: San Salvador

now known as the Bahamas

In this unit, you learned about ancient civilizations that existed in Asia and the Americas. What were the major achievements of each civilization? Of the achievements that you identified, which do you think had the biggest significance in world history? Why?

Answers

Answer:

Achievements of each civilization:

Sumer - first recorded civilization in world history according to historians, first system of writing (cueniform script).

Ancient China - the four great inventions: paper, gunpowder, the compass, and the printing press.

Ancient Hindus Valley Civilization - first civilization to incorporate sanitation infraestructure in their cities.

Ancient Persia - first to develop a trade route that connected Asia, Europe and Africa. First to develop a postal service.

Inca Empire - terrace farming in a very steep geography.

Mayan Empire - great achievements in astronomy, including the famous Mayan calendar. Impressive Pyramids that rival those of Ancient Egypt.

Of the achievements that you identified, which do you think had the biggest significance in world history? Why?

All the achievements listed above are quite impressive, however, it is probable that the most influential achievement is Ancient China's four great inventions.

Paper and the printing press changed the writing industry. Gundpowder chaged war forever, making gundpowder weapons the most common choice for war. The compass also changed navigation systems.

These four inventions were groundbreaking.

Why might Northern Italy have been a good place for the Renaissance to begin? its central location in Europe its location in Asia its proximity to the Mediterranean Sea its small size compared to other countries

Answers

Answer:

its central location in Europe

its proximity to the Mediterranean Sea

Explanation:

Renaissance period was the period which came after the Middle Ages and it was characterized by a lot of new innovations and reforms in various aspects such as political, artistic and economic.

Northern Italy would have been a good place for Renaissance to begin due to its central location in Europe and its proximity to the Mediterranean Sea. This would have encouraged a faster spread to more countries.

NEED ANSWER ASAP!!!!!
Because of the way the Berlin blockade ended, one could argue that the first struggle in the Cold War was won by the West. What would be a reason to make this statement?

Answers

Answer:

Although no shots were fired, the Berlin blockade was the first case of a direct conflict between the West and the Soviet Union. The blockade was an attempt by the Soviets to gain control over Berlin. But the airlift crushed their plan. As a result, the Soviets backed down from the conflict, which could be seen as a victory for the West.

Explanation:

This is the exact answer for Plato or Edmentum users.

Answer:

Although no shots were fired, the Berlin blockade was the first case of a direct conflict between the West and the Soviet Union. The blockade was an attempt by the Soviets to gain control over Berlin. But the airlift crushed their plan. As a result, the Soviets backed down from the conflict, which could be seen as a victory for the West.

Explanation:

What was the relationship between Johnson’s Great Society and poverty trends between 1960 and 1980? poverty increased significantly as a result of the Great Society it did not affect poverty much over that time poverty was eliminated by the Great Society the level of Americans living in poverty decreased significantly during that period

Answers

Answer:

When Johnson announced his Great Society program in 1964, he promised to reduce poverty, alleviate hunger and malnutrition, expand community medical care, provide adequate housing, and enhance the employability of the poor. ... Thirty-three million poor people competed for just 600,000 public housing units.

Explanation:

What purpose should are government serve?

Answers

To establish laws, maintain order, and provide security, protect citizens, and promote the general welfare.

which statement best describes the griswold v. connecticut case

Answers

Answer:

A. It was related to privacy because it concerned medical guidance for patients.

Explanation:

edg 2021

Which event organised peace between Germany and the allied forces at the end of word war I ? A. the armistice B. the Spanish flu pandemic C. the signing of the Treaty of Versailles D. the signing of the Treaty of Brest-Litovsk

Answers

Answer:

C- The Treaty of Versailles

Explanation:

The treaty ended WW1.

Answer:

C

Explanation:

Which statement best describes the fossil record?
O It is a complete record.
O It is an incomplete record.
Most fossils are older than five billion years.
All fossils are younger than six hundred years.

Answers

Answer:

It is an incomplete record.

Explanation:

The fossil record is an account of known entities that have been found by scientist and historians that attempts to reconstruct the history of creatures and events that happened on Earth.  The fossil record has massive gaps that haven't been able to be filled; however, there still are lots that have been discovered.  The fossil record will be incomplete for quite a long time.

Answer:

The answer is B

Explanation:

This is because the earth was created 4.6 billion years ago and humans have found fossils from around 1+ billon years ago.  There is also no way that the fossil record is complete because some if not most fossils have been berried way to deep for humans to get to.

Discoveries of artistic works from early men and women include all of these except

Answers

Answer:

The answer would be watercolor painting.  I did this too and good luck

Compare and contrast the British in India and China. Describe how the British East India Trading Company was instrumental in taking power in India and attempting to take control in China. Outline the path the British took to ruling India compared with the path they took in China. What prevented them for ruling China? Structure: Describe the British in India - from initial traders to rulers Describe the British in China - from traders to conflict State the major differences between the two countries interaction with the British and the reasons behind the differences.

Answers

Answer: i never learned this

Explanation:

The industrial revolution in Europe: Group of answer choices produced the first specialized industries anywhere in the region caused a large immigration of workers from other parts of the world to fill the available jobs in the factories initially was focused in England, where machinery was invented and the use of steam to drive engines emerged gave enormous situational advantage to large cities such as London and Paris, positioned on coal fields and near iron ores

Answers

Answer:

Correct Answer:

The industrial revolution initially was focused in England, where machinery was invented and the use of steam to drive engines emerged

Explanation:

Industrial Revolution, is the process  whereby a region or country changes from an agrarian and handicraft economy to one dominated by industry and machine manufacturing. The main features involved in the Industrial Revolution were technological, socioeconomic, and cultural.And the process began in Britain in the 18th century and from there spread to other parts of the world.

Southerners thought that European nations would recognize and support the Confederacy because of the Europeans' desire to upset the global balance of power. wish to back the winning side. lack of economic ties to the North. dependence upon southern cotton.

Answers

Answer:

dependence upon southern cotton.

Explanation:

The confederacy were majorly involved in the production of crop such as cotton which were used to make textile materials and European countries were majorly dependent on them for this item.

This made the Southerners during the war to think that European nations would recognize and support the Confederacy because of the Europeans' dependence on the cotton.

What are civic duties? Give three examples.

Answers

Answer:

Civic duties ensure that democratic values written into the Constitution and the Bill of Rights are upheld.

Explanation:

•Support and defend the Constitution.

•Stay informed of the issues affecting your community.

•Participate in the democratic process.

•Respect and obey federal, state, and local laws.

Answer:

[tex] \boxed{ \bold{ \sf{see \: below}}}[/tex]

Explanation:

Every citizen does have certain responsibilities towards their country because of belonging to the country concerned. Civic duties are the duties to be fulfilled by the citizens to their nation. Not fulfilling the civic duties is considered as not accepting the country.

Examples :

Paying tax regularlyRaising voice for the cause of truth and justiceParticipate in the election, casting vote fairly to choose the best candidateInvolving in the developmental activities and contributing for peace and securityRaising voice for the protection of national territory , sovereignty, nationalityDrawing attention of the concerned authorities when fundamental rights are violated.

Hope I helped!

Best regards!!

PLEASE HELP!!! WILL BE GIVING BRAINLIEST TO A PERSON!!!

How was the Gulf of Tonkin Resolution received in Congress? A. It divided Congress by party lines B. It never went through Congress, only through the President C. They were actively opposed to it D. It was nearly unanimously supported

Answers

Answer: B

Explanation: My Grandma was a history major and she said so

Which statements best describe the Battle of Stalingrad? Check all that apply.

Answers

Answer:

-The Soviets forced the Germans to surrender.

-It was one of the bloodiest battles of the war.

-An estimated two million people died.

Explanation:

I got the answers from another app. Hope it helps

An important part of Manifest Destiny was the idea that the United States should expand until it reached?

Answers

Answer:

the Pacific Ocean

Explanation:

Answer:

B or the Pacific Ocean

Explanation:

HAVE A GREAT WEEK STAY SAFE!

Why does Travis kill eckels? Explain your answer

Answers

Travis kills Eckels because, by leaving the path and stepping on a butterfly, Eckels has destroyed their reality. The world they return to is similar...
Travis kills Eckels because, by leaving the path and stepping on a butterfly, Eckels has destroyed their reality. Eckels disobeyed the rules of traveling back into time to the dinosaur age—but as we will see, Bradbury implies it is more complicated than that.

Explain the development of the southern colonies, including but not limited to reasons established, impact of location and place, relations with American Indians and economic development?

Answers

The correct answer to this open question is the following.

We are talking about colonial times in North America, where white English people left Britain in order to pursue new goals and have better opportunities in the new continent.

The development of the southern colonies stemmed from the effort and perseverance of the people. The southern colonies were Maryland, Virginia, and Carolina, which years after divided in two: North and South Carolina. The location and place of these southern colonies were an important factor for their development. The good soil of the land and good climate conditions allowed farmers to grow great crops to the degree that southern colonies were known as the "breadbasket of America." They exported their crops to Europe, where there was a big demand for corn, Indigo, rice, and tobacco. This represented a big advantage for economic development.

Regarding the relations with Native American Indian tribes, at first, colonists tried to maintain a peaceful coexistence to try to live in harmony with them, but things complicated when more people arrived at these regions and tried to exploit more raw materials that were in the Indian territories.

How did Louisiana's political boundaries change since it's founding the French in 1682

Answers

Louisiana (French: La Louisiane; La Louisiane française) or French Louisiana[1] was an administrative district of New France. Under French control 1682 to 1762 and 1801 (nominally) to 1803, the area was named in honor of King Louis XIV, by French explorer René-Robert Cavelier, Sieur de la Salle. It originally covered an expansive territory that included most of the drainage basin of the Mississippi River and stretched from the Great Lakes to the Gulf of Mexico and from the Appalachian Mountains to the Rocky Mountains.

Since its founding by the French in 1682, Louisiana’s political boundaries changed in such a manner that originally LA was all the land between the Appalachian Mountains and the Rocky Mountains were Louisiana. Hence, Option A is correct.

What is a political boundary?

A line that is imaginary is drawn with the purpose of separating one political unit from the neighboring one is known as the political boundary. The basis on which any political boundary is being drawn is natural geographic features.

In the context of Louisiana, which is also termed an administrative district of New France was under the control of the Frech rulers from 1682 till 1762 and also from 1801 till 1803.

For giving honor to King Louis XIV, the area was renamed by French explorers René-Robert Cavelier, and Sieur de la Salle. It was an expanded territory, that covered the area near the Mississippi River, Great Lakes, Gulf of Mexico, the Appalachian Mountains to the Rocky Mountains.

Thus, Option A is correct.

Learn more about  political boundaries here:

https://brainly.com/question/1802615

#SPJ2

The complete question is attached in text form:

How did Louisiana’s political boundaries change since its founding the French in 1682?

Originally, LA was all the land between the Appalachian Mountains and the Rocky Mountains were Louisiana.

The Mississippi River became our eastern border when the Spanish took over and is still part of our eastern border today.

Today one part of our western border is the Sabine River.

The Gulf Coast is now our Southern border, unlike Louisiana's colonial days.

In four to five sentences, give an example of distribution of power in hour family or at your school. How is power divided among the members of your family or within your school? Why do you think the decision was made to divide power that way?

Answers

Answer:

Distribution of Power can be defined as the extent or way power is shared in a unit.

                   

                          DISTRIBUTION OF POWER IN MY SCHOOL

In my school, we have a basic power structure and the distribution of power is divided between the headmistress, principal, and teachers.

The Headmistress is the owner of the school and her decision is final. She decides the salary structure, school uniforms, teachers that will be employed, and other extremely important things. The principal reports to her.

The Principal is in charge of the administrative part of the school as he monitors the performance of teachers, supervises the students, and other administrative functions. The teachers answer directly to him, and in turn, he reports his findings to the Headmistress.

The teachers are in charge of imparting academic and moral knowledge to the students. They teach them in the classroom, give them tests and assignments, mark and grade them. They are also allowed to discipline erring students. They answer directly to the Principal, although in some cases, the Headmistress can ask the situation report from the teachers directly.

Who is the Greek god of wine?

Answers

The Greek god of wine is Dionysus

Answer: Bacchus

Explanation:

Why is the Declaration of Independence an important document?

Answers

The Declaration of Independence is a document written in 1776.

It is one of the most important documents in history in the United States.

This document said that the United States of America was a free and independent country and also told us about the rights of every citizen.

The main reason it was written is because colonists were very upset with

how the British controlled things and they wanted their own country.

So this document was basically a message to the world

saying that the United States of America was its own nation.

Thomas Jefferson wrote this document over the summer of 1776 and

this important document is held at the national archives.

Below, you can see what it looks like.

At the national archives, it is under very thick glass.

Answer:

The declaration of independence was they approve by the continental congress on 4 July 1776.  

Explanation:

The declaration of independence has always celebrate in united states as great national holiday in america  or 4 July independence day.

As they american revolution during the 1775 to 1776 an great Britain, large arms force and majority of Americans an secure to right the empire outside.

Independence time congress already toward long step severing in Britain,over the  colonies as establish government choice and declared to the power of government.

The congress is the made a more change of the British people reference to scotch an foreign mercenaries, that the declared contained  it political philosophy.

Declaration of independence that support a legislature and that agreement between governor and the Americans governed,government contract theory has political scientists.

Declaration of independence are not they sufficient to power force that the document is unsound and they politically valid.

As a ruler, Emperor Qin Shihuangdi A. Consolidated power in the capital. B. Was elected by the noble houses. C. Embraced Confucianism over legalism. D. Was traditional and made few changes.

Answers

As a ruler, Emperor Qin Shihuangdi:

Choose A: Consolidated power in the capital.

As a ruler, Emperor Qin Shihuangdi consolidated power in the capital.

Emperor Qin Shihuangdi was the founder of the Qin Dynasty.The capital Xianyang expanded to form the capital of the newly unified empire. The capital became the centre of bureaucracy and power.Qin dynasty had 36 provinces and was controlled by a governor, a military commander, and an inspector.

Therefore we can conclude that Emperor Qin Shihuangdi consolidated power in the capital.

Thus option A is the correct answer.

Learn more about Emperor Qin Shihuangdi here:

brainly.com/question/13876260

What is citizen participation? How do citizens participate in an authoritarian (autocracy), oligarchic (oligarchy) and democratic form of government

Answers

Answer:

Citizen participation refers to the citizens' involvement in their country's government. In an autocracy, there is often very little citizen participation. The power lies solely in the government, most likely in just one person. One example of an autocratic government is a monarchy. In which, the King or Queen holds all the power. Citizen participation is not a priortiy in this form of government. In an oligarchy, a group of people are in control. Usually, this group is a higher/richer class. A democratic government, however, involves more citizen participation than arguably any other government form. In a democratic system, the citizens make most of the important decisions. Presidents, represenatives, law-makers, etc. are all elected by the citizens.

What’s a Clovis point, and what does it tell us about the way the North American continent was settled by human beings? Choose 1 answer:

Answers

It's a sharpened stone tool, and it tells us that humans have been on the North American continent for at least 13,500 years
It's a sharpened stone tool, and it tells us that humans have been on the North American continent for at least 13,500 years

At the nationally televised Army-McCarthy hearings in 1954, it was revealed that Group of answer choices McCarthy gloated that he was right and the army had been willing to look the other way to save their reputation. neither side was able to prove their point; Congress dropped the charges as there was insufficient evidence. McCarthy was not fit to stand trial; instead he sent his assistant to read the charges, which could not be entered into evidence without McCarthy's physical appearance in the hearings. McCarthy was a bully who browbeat witnesses and made sweeping accusations with no basis in fact.

Answers

Answer:

Option: McCarthy was a bully who browbeat witnesses and made sweeping accusations with no basis in fact.

Explanation:

Senator Joseph McCarthy began the period of McCarthyism in America during the 1940s and 1950s. During this period, many Americans arrested as Communist agents without precise evidence. During the McCarthy period, hundreds of Americans accused of being communists and questioning before the government.  The fear of the Soviet Union led hundreds of Americans sent into prisons while thousands lost their positions in office. The prime targets of doubts were government employees. His hunt ended when he attacked several U.S. Army officers for having communist sentiments. Many accused him of being a tyrant who used power in a wicked way and never produced a proper document.

In response to Fort Sumter President Lincoln asked Congress to initiate plans for military conscription. both North and South witnessed a tremendous outpouring of support. the states of Maryland, Kentucky, and Missouri seceded and joined the Confederacy. Northern authorities began drafting Blacks for military service.

Answers

The correct answer is B) both North and South witnessed a tremendous outpouring of support.

In response to Fort Sumter, both North and South witnessed a tremendous outpouring of support.

We are talking about the Battle of Fort Sumter, in Charleston, South Carolina, that represented the beginning of the American Civil. Indeed, it was the first battle of the war between the Union army and the Southern troops. It started on April 12, 1881, and ended one day later with the victory for the Southern army. Major Robert Anderson led the Union army, and the Southern troops were led by General B.T. Bearugerard. The battle did not report any casualties, but the Civil War had begun.

Other Questions
In a survey of adults in a certain country conducted during a period of economic uncertainty, % thought that wages paid to workers in industry were too low. The margin of error was percentage points with % confidence. For parts (a) through (d) below, which represent a reasonable interpretation of the survey results? For those that are not reasonable, explain the flaw. how many are 2 raised to 2 ??? Choose the PCR primer pair that will amplify the breakpoint of a deletion of the segment of DNA between lines 1and 2. 5' TCGATTCCGGAAAGCTTAGTTTCCCGGGACGTATTGCCAACCTAGGTAAGCGCCGAATATCCATGGGCACC 3'3' AGCTAAGGCCTTTCGAATCAAAGGGCCCTGCATAACGGTTGGATCCATTCGCGGCATTATAGGTACCCGTGG 5'a. 5- AGCTAAGGCCTTTCGA and 5'-CCACGGGTACCTATAA b. 5'- TCGATTCCGGAAAGCT and 5'-ACGTCCCGGGAAACTA c. 5- TCGATTCCGGAAAGCT and 5'-CCACGGGTACCTATAA d. 5'- TCGATTCCGGAAAGCT and 5'- GGTGCCCATGGATATT e. 5' - GGTGCCCATGGATATT and 5' ACCTAGGTAAGCGCCG This rectangular patio is tiled using 50 cm by 50 cm square tiles. How many tiles are used? Imagine that you are the supply chain manager for the Magic Widget company and you need to measure your supply chain performance. The chart shows the financial variables that you will need to perform your task. Financial Variables Total Assets (in $ billions) 15.1 Cost of Goods Sold (in $ billions) 14.3 Inventory: Raw Material Inventory (in $ billions) 0.76 Work-in-progress Inventory (in $ billions) 0.12 Finished Goods Inventory (in $ billions) 0.82 Compute the percentage of assets committed to inventory and inventory turnover. What is the quotient of 35,423 15? The plateau phase of population growth is best described as: A. The population stops growing because they moved into the plateau environment at this stage. B. The population pauses in its growth after a natural disaster before growing again. C. The population moves onto a large, raised, flat area called a plateau for protection from predator. D. The population stops growing because the environment has reached its carrying capacity. The Coriolis effect Choose one: A. causes north-flowing currents in the northern hemisphere to curve to the west. B. causes the same direction of deflection in the northern and southern hemispheres. C. is a deflection of wind or water flowing over the Earth's surface. D. is a phenomenon created by the movement of ocean currents. Light passes through a single slit. If the width of the slit is reduced, what happens to the width of the central bright fringe Our Senate has finally emerged from weeks of debate with a decided version of the Missouri Compromise. Among its list of provisions, all lands acquired in the Louisiana Purchase that are north of the southern border of Missouri, with the exception of Arkansas, will now d. Write the symbol for the nucleus that completes each nuclear equation. (1 point each) URGENT PLS HELP ASAP! THANK YOU :) What is the x-value of point A? I need some help plsssssssssssss Which of the following is a characteristic of outer planets?O Close to the sunFew moonsHave ringsRocky surfaces Find the formula for the inverse function.f(x)=2/3-4x Assume you have created a class named MyClass and that is contains a private field namedmyField and a nonstatic public method named myMethod(). Which of the following istrue?a. myMethod() has access to and can use myFieldb. myMethod() does not have access to and cannot use myFeild.c. myMethod() can use myField but cannot pass it to other methods.d. myMethod() can use myField only in myField is passed to myMethod() as aparameter. what in your home would be considered something you could study in biology? Questions attached below (`) (If gets it right get's brainliest)If the hypotenuse of an isosceles right triangle is 14, what is the area of the triangle?