At high altitudes, air is less dense than at sea level because of decreased air pressure. This means that a person who ascends to high altitudes takes in fewer oxygen molecules per breath. Describe and explain an immediate response that occurs in the circulatory system when a person first reaches high altitudes. Use vocabulary from class.
An immediate response that occurs in the circulatory system when a person first reaches high altitudes is that the heart beats faster to meet the demand for oxygen that the body needs.
What are the main effects of altitude?The higher it is, the worse the symptoms, which include
headacheshortness of breathrapid heartbeatamong othersNot everyone has these symptoms when they go to high-altitude places, but it is also not possible to know who will or will not feel something.
With this information, we can conclude that An immediate response that occurs in the circulatory system when a person first reaches high altitudes is that the heart beats faster to meet the demand for oxygen that the body needs.
Learn more about high-altitude in brainly.com/question/14756132
#SPJ2
Can someone plz help
A science researcher has developed a computer model of the process of DNA replication in a eukaryotic cell. The model includes the following sequence of bases in one strand of the DNA molecule. AACCTGGCCATGGACCTTTATATAAACTAGGAT The researcher wants to revise the model to show the transcription of DNA to form mRNA. Identify the choice that best completes the statement or answers the question. Which of these revisions to the model would be most useful for the researcher to include
Answer: Identify the promoter and the stop signal (terminator).
Explanation:
DNA is a molecule that contains the genetic information in all living things. This information is used for the synthesis of proteins that make up the body and carry out vital functions of the organism.
The DNA molecule consists of two strands that wind around each other to form a double helix structure, where each strand has a central part formed by sugars (deoxyribose in the case of DNA) and phosphate groups. The four basic components of DNA are nucleotides: adenine (A), thymine (T), guanine (G) and cytosine (C). The nucleotides are joined together (A to T and G to C) by chemical bonds and form base pairs that connect the two strands of DNA. Depending on the sequence of nucleotides (which have different bases), different proteins are synthesized.
DNA replication consists of synthesizing another identical DNA molecule, using enzymes called polymerases, which are molecules specifically dedicated only to copy DNA. Transcription, on the other hand, is the process by which a copy of messenger RNA (mRNA) is generated from the sequence of a gene in the DNA. This RNA molecule leaves the cell nucleus and enters the cytoplasm, where it directs protein synthesis (a polymer made up of many amino acids).
Protein synthesis, or translation, involves translating the sequence of an mRNA molecule into an amino acid sequence during protein synthesis. The genetic code describes the relationship between the sequence of base pairs in a gene and the corresponding sequence of amino acids it encodes. To begin translation, a start codon (set of 3 bases) must first be identified, which is usually AUG that also codes for the amino acid methionine. Then, the codons that follow are read and the corresponding amino acids are added according to the genetic code. The transfer RNA (tRNA) is complementary to the anticodon at specific codons in the messenger RNA and carries the amino acid coding for the codon. In addition, ribosomal RNA (rRNA) is an RNA that is part of ribosomes and is essential for protein synthesis in all living things. rRNAs form the framework of ribosomes and associate with specific proteins to form ribosomal pre-subunits. To finish the translation, a termination codon has to be read, which can be UGA, UAG or UAA.
To revise the model to show transcription to form mRNA, the research should identify the promoter and the stop signal. The promoter is a DNA sequence required to turn a gene on or off. The transcription process starts at the promoter which is usually located near the beginning of a gene and has a binding site for the enzyme that is used to make a messenger RNA (mRNA) molecule. The enzyme RNA polymerase will keep doing the transcription until it reaches a sequence of DNA that is signal which indicates it should stop. This process is called termination, and it happens once the enzyme reaches this sequence, called terminator.
What is the mrna sequce of the T T C A A T G G T C T A G G G
Answer:
AAGTTACCAGATCCC
Explanation:
always remember, you would just switch them, The Opposite Of T is A and The Opposite of G is C, and vise versa.
nutrients are transported to the organs of the bloodstream by which system
Answer:
The blood circulatory system delivers nutrients and oxygen.
Explanation:
A man has Huntington's disease (a dominant trait) and a heterozygous genotype. He has four children with a woman who does not have Huntington's disease. What are the odds their children will inherit Huntington's disease?
Answer:
50/50
Explanation:
Question 21 (1 point) Sustainable use is often defined as the use of natural resources at a rate that meets the needs of the present human population but which also allows future generations to use the resource to meet their needs. Which of these BEST illustrates the concept of sustainable use? A fishing trawler uses a large net to catch a school of small fish A logging company reseeds and replants in a forested area after cutting down trees for timber Crops are rotated in a farmer's field to maximize grain yields Coal is mined using underground tunnels to avoid the destruction of surface soils by strip mining
Answer:
A logging company reseeds and replants in a forested area after cutting down trees for timber
Explanation:
Answer:
Sustainability is the capacity to endure in a relatively ongoing way across various domains of life.[1] In the 21st century, it refers generally to the capacity for Earth's biosphere and human civilization to co-exist. It is also defined as the process of people maintaining change in a homeostasis-balanced environment, in which the exploitation of resources, the direction of investments, the orientation of technological development, and institutional change are all in harmony and enhance both current and future potential to meet human needs and aspirations.[2][failed verification] For many in the field, sustainability is defined through the following interconnected domains or pillars: environmental, economic and social,[3] which according to Fritjof Capra,[4] is based on the principles of systems thinking. Sub-domains of sustainable development have been considered also: cultural, technological and political.[5][6] According to Our Common Future, sustainable development is defined as development that "meets the needs of the present without compromising the ability of future generations to meet their own needs."[7][8] Sustainable development may be the organizing principle of sustainability, yet others may view the two terms as paradoxical (seeing development as inherently unsustainable).[9]
Explanation:
meaning of cell or cytology
Answer:
the smallest structural and functional unit of an organism, typically microscopic and consisting of cytoplasm and a nucleus enclosed in a membrane.
Explanation:
Cell is the building blocks of life.
hey can someone answer pls?
will mark branliest and follow thanks!
A is correct
////
key word different
AAAAAAAAAAAAAAAAAAAA
Observing Animals (Image Attached)
Let’s study and compare three animals: a frog, an ancient and extinct mammal-like animal, and an owl. Observe the illustrations, and then answer the questions.
1. How are the bodies of the three animals similar to one another? How are they different?
2. What might these similarities suggest about the common ancestor of these organisms?
Answer: They each have patches on their stomachs. Also, all 3 animals have claws or legs, even though they play different function in each organism, they 3 still share the same characteristics of having claws or legs.
Explanation:
I am also trying to understand the 2nd question, but this is the answer to the 1st one.
What type of microscope would you use to view a live sample?
1. Scanning Electron Microscope
2.Transmission Electron Microscope
3.Magnifying glass
4. Light Microscope
Answer:
Compound microscopes
Compound microscopes are light illuminated. The image seen with this type of microscope is two dimensional. This microscope is the most commonly used. You can view individual cells, even living ones.
You cross nonpure tall plants (Tt) and produce 200
offspring. Which of the following statements about
the offspring is correct?
A. All of the offspring will definitely be tall.
B. 150 of the offspring will definitely be tall.
C. There is a 75% chance that each offspring
will be tall.
O D. There is a 25% chance that each offspring
will be tall.
Answer:
C is the best answer
Explanation:
the dominate trait is in 3 of the four boxes
There is a 75% chance that each offspring will be tall. Therefore option C is correct.
When you cross non-pure tall plants (Tt), you are dealing with a heterozygous genotype, meaning the plants have one dominant (T) and one recessive (t) allele for the height trait.
The dominant allele (T) is responsible for the tall phenotype, while the recessive allele (t) leads to short plants. In this case, 75% of the offspring will likely receive the dominant allele from at least one parent (Tt or TT) and therefore be tall.
The remaining 25% will inherit the recessive allele from both parents (tt) and be short. This is based on the principles of Mendelian genetics and the Punnett square.
Therefore option C There is a 75% chance that each offspring will be tall is correct.
Know more about genotype:
https://brainly.com/question/31515990
#SPJ5
Do you think aluminum foil is a good insulator or conductor? Why? Give data ( I'm talking about numbers here)
Answer: hewo, There! your Answer is Below ;w;
aluminum foil reflects the emission of heat, it tends to be a better insulator than other materials that just slow down the flow of heat from one area to another. So It is a Good Insulator,
Explanation:
aluminum foil is a good insulator because it prevents the radiation of heat by reflecting it back at the source.
Hope this helps!
Have a great day!!!
-August-
Which type of human population is characterized by the lag phase, being able to raise crops and domesticated animals, but having over farming methods that lead to soil eorion and food shortages?
Answer:
Rural population.
Explanation:
The rural population of humans is characterized by the lag phase because they are linked with farming of crops and domesticated animals. This population is responsible for the soil erosion and food shortages over the country because they are the producers of everything for the food industry. Due to farming methods, soil erosion occurs that leads to the depletion of nutritive part of the soil that causes less productivity of the crop and as a result food shortage occur.
Why is it we cannot directly observe a genotype, but can sometimes infer it?
Some flowers show incomplete dominance. If RR = white and R'R' = red, which phenotypic ratio would
be expected in the o spring of two pink flowers?
Answer:
1 red: 2 pink: 1 white
0 red: 4 pink: 0 white would be the phenotypic ratio expected in the o spring of two pink flowers. So, the correct option is (D).
What is Phenotypic ratio?Phenotypic ratio defined as the relative number of offspring expressing a particular trait or combination of traits, which can be determined by performing a test cross and the frequency of the trait or trait combinations being expressed depending on the genotype of the offspring can be identified.
Phenotypic ratio is expressed as the ratio of different phenotypes present in the progeny of a cross where the ratios are numerical comparisons. For example, if one has three mangoes and two oranges, the ratio of mangoes to oranges will be 3:2.
For above given information, if we cross RR which is white with R'R' which is red, we will get 4RR' offspring which are pink in color. then the ratio will be 0 red: 4 pink: 0 white.
Thus, 0 red: 4 pink: 0 white would be the phenotypic ratio expected in the o spring of two pink flowers. So, the correct option is (D).
Learn more about Phenotypic ratio, here:
https://brainly.com/question/11552649
#SPJ6
A population of lowers is separated by an eight-lane superhighwax, Pollen is often camed by the
and across the highway and can pollinate the flowers on the other side of the highway Can speciation
occur in this situanon2
No because the populations are not reproductively isolated
Ne because the populanons are not geographically isolated
Ces because the populations are reproductively isolated
Yes because the populations are geographically isolated
DONE
Fr
Answer:
hi
Explanation:
Answer: A) No, because the populations are not reproductively isolated.
Explanation: :)
please help me with my science will give brainlest help asap 2 question, please dont answer just for points :(
Answer:
1. 50cm
2. Direct
Explanation:
1. The distance pulled back means you get your answer from the distance pulled back data. Since 50cm is the largest of your given data, that makes the cart go farthest.
2. The farther you pull the band back, the farther the cart will go. Since both increase when you increase the distance you pull the band back, this is a direct relationship.
Which problem do you think contributes most to water scarcity?
Answer:
QUESTION:
Which problem do you think contributes most to water scarcity?
ANSWER:
Water shortages may be caused by climate change, such as altered weather patterns including droughts or floods, increased pollution, and increased human demand and overuse of water. A water crisis is a situation where the available potable, unpolluted water within a region is less than that region's demand.
Explanation:
Hope that this helps you out! :)
If you have any questions please put them in the comment section below this answer.
Have a great rest of your day/night!
Please thank me on my profile if this answer has helped you.
2. Describe the info flow of transcription. (A. DNA --> DNA / B. DNA -> RNA / C. RNA --> protein / D.
DNA --> protein)
3. Describe the info flow of translation. (A. DNA -> DNA / B. DNA -> RNA / C. RNA --> protein / D. DNA-
-> protein)
4. Describe the info flow of expression. (A. DNA --> DNA/B. DNA --> RNA / C. RNA --> protein / D. DNA
--> protein)
5. Describe the info flow of replication. (A. DNA --> DNA/B. DNA --> RNA / C. RNA --> protein / D. DNA-
-> protein)
Answer:
I think the dna is like in the butt but I really have no key to my hose
Explanation:
jsnfjfnf
I NEED HELP ASAPPP PLEASE
C. When the arm extends (straightens), which muscle contracts?
Explanation:
When your biceps muscle in your upper arm contracts, it pulls your lower arm in towards your shoulder. However, when it relaxes, your biceps cannot push your arm back out. To do this, your triceps muscle, on the underside of your upper arm, contracts and straightens your arm out.
Answer:
When your biceps muscle in your higher arm contracts, it pulls your lower arm in to your shoulder. when it relaxes, your biceps cant push your arm back out. and straightens your arm out.
Explanation:
of the following are abiotic factors in an ecosystem except _______.
Select one:
a.
types of minerals
b.
ocean currents
c.
types of bacteria
d.
temperature
PLEASE HELP 5TH GRADE SCIENCEEEE AHHHHHHHHH PLEASE HELP ME IM GONNA FAIL IF I DONT GET THIS Alanna spots a bird in her back yard. The bird is sitting on a tree. Explain how the outer coverings of the bird and tree are different and have different functions.
Answer:
The purpose of the outer covering of the bird helps keep it warm and to help it fly, whilst the outer cover of the tree is to protect it from bugs.
Explanation:
Answer: Bird: helps protect it from the environment. Tree: To help reduce water loss.
Explanation:
The outer covering of the bird helps protect it from cold weather, while the outer covering of the tree helps it to reduce water loss.
Please give it a 5 star!
Humans, and other animals, exhale
A. oxygen
B. natural gas
C. carbon dioxide
D. cytoplasm
Answer:
C
Explanation:
Humans,and other animals,exhale carbon dioxide and inhale oxygen.
Answer:
c: humand and animals exhale carbon dioxide
Proteins and polysaccharides are polymers. These polymers are formed by dehydration synthesis. Which statement correctly identifies a difference in the structure of proteins and polysaccharides? *
A. forming a variety of gametes that will pass on hereditary information
B. disrupting meiosis and the synthesis of amino acids into a sequence
C. producing the inorganic molecules needed for normal cell growth
D. directing the synthesis of proteins necessary for proper cell function
D. directing the synthesis of proteins necessary for proper cell function
I hope this helps a little.
Whenever energy appears in one system,
A.
it must have come from somewhere else.
B.
it means the system is suitable for creating energy.
C.
it must be used quickly or it will be permanently lost.
D.
it means energy creation has outpaced energy destruction.
Answer:
it must have come from somewhere else.
Explanation:
I did it on studyisland
PLSSS HELP IMMEDIATELY!!!!! i need help rn!! only help if u know, i’ll give brainiest if u don’t leave a link
Answer:
Its keen eye sight helps it to see prey from the sky
Explanation:
Second option, doesn't make sense because their white and brown feathers aren't used for camoflouge
Third option, bald eagles fly not swim
Fourth option, bald eagles use their beaks for critical tasks, such as building nests, catching food and preening.
Need help, I will give branliest
Answer:
Supergiants
Explanation:
Which of these mammals are native to Virginia
Armadillo
Camel
Kangaroo
Squirrel
(Don’t leave links)
Answer:
Right a way, we know that a camel or a kangaroo are NOT native to Virginia. Now we have the armadillo and the squirrel.
"Originally native to South America, the armadillo now ranges as far north as Texas, Oklahoma, Kansas, Louisiana and Florida." - so we can rule out armadillos!
Virginia has 4 different kinds of squirrels that are native, so squirrel would be your answer.
Hoped this helps!
The San Andreas Fault marks the boundary between which two tectonic plates?
Answer:
The San Andreas Fault is the transform plate boundary where a thin sliver of western California, as part of the Pacific Plate, slides north-northwestward past the rest of North America