How many chromosomes are present in human sex cells at the end of meiosis

Answers

Answer 1

Answer:

23  

Explanation:


Related Questions

Molecules of DNA are composed of long chains of?

Answers

two long polynucleotide chains

A DNA molecule consists of two long polynucleotide chains composed of four types of nucleotide subunits. Each of these chains is known as a DNA chain, or a DNA strand. Hydrogen bonds between the base portions of the nucleotides hold the two chains together

Molecules of DNA are composed of long chains of nucleotides.

What are nucleotides?

Nucleotides are the building blocks of DNA  and RNA adenine (A), thymine (T), guanosine (G), and Cytosine (C. In RNA, uracil (U) is present instead of thymine.

The pentose sugar is the ribose sugar in RNA and deoxyribose sugar in DNA. In deoxyribose sugar, oxygen is absent from the 3' carbon.

Phosphate groups are attached through the 5-C of pentose sugar by an ester bond. One polynucleotide chain is formed when the phosphate of one nucleotide forms a phosphodiester bond with the sugar of another nucleotide.

A double-stranded structure is formed by base pairing between nucleotides. The adenine binds to thymine by two hydrogen bonds and guanine binds to cytosine by three hydrogen bonds.

Therefore the molecules of DNA are composed of long chains of nucleotides.

Read more about nucleotides, here

https://brainly.com/question/13185536

#SPJ6

⚠️Second time posting this⚠️
Geneticists use Punnett Squares to show all the possible outcomes of a genetic cross and to determine the probability of a particular outcome.
True
or
false

Answers

Answer:

True

Explanation:

Scientists only use punnet squares if they want to determine what the possible outcomes will be for the offspring.

Hope this helps, if it is wrong, I am sorry. T^T

Answer:

   true

Explanation:

Please help I will mark brainliest

Answers

Its b

Mark me brainliest

Explanation:

Answer:

B

Explanation:

because I already did that

What kind of inheritance is horse color an example of?

A. Complete dominance
B. Incomplete dominance
C. Co-dominance

Answers

i think the answer would be a , because of the certain color is more popular than an another based on the the gene but i can be completely wrong , correct me if i am :)

Which of the following best describes the cell below?
Capsule
Cell wall
Plasma membrane
Cytoplasm,
Ribosomes
Plasmid
P
Bacterial Hagellum
Nucleoid circular DNA)
OA
prokaryotic cell
OB
plant cell
OC.
protist cell
OD
eukaryotic cell

Answers

The answer is A. Prokaryotic cell

Pls I need answers at least one answer of any of the questions

Answers

Have you ever wondered how many times your heart beats in a day, a month, a year—or will beat in total throughout your life? Over an average lifetime, the human heart beats more than 2.5 billion times. For a person to keep their heart healthy, they should eat right, not smoke and get regular exercise. In this science activity, you'll measure your heart rate during different types of physical activities to find out which gives your heart the best workout to help keep it fit.
Background
A 150-pound adult has about 5.5 liters of blood on average, which the heart circulates about three times every minute. A person's heart is continuously beating to keep the blood circulating. Heart health experts say that the best ways to keep our hearts healthy is through a balanced diet, avoiding smoking and regular exercise.

The _______________ rate describes the rate at which the atmosphere gets colder as the air gets thinner at higher altitudes.

Answers

Answer:

Lapse rate

Explanation:

AHHHHSHYNJTNXT WHYYYYY

What type of mutation is shown in the example below?
Original DNA: ATCGTCGTCGT
Mutated DNA: ATCGTCGTGT

Answers

It is a deletion mutation

If the process of meiosis shown to the right proceeds
normally, how many
chromosomes will cells A, B, C, and D have?
B

Answers

Answer:

If I’m correct it’s 15

Explanation:

What parts of the body make up the central nervous system

Answers

Answer:

brain and spinal cord

Explanation:

that's it

Once assembled, what is the key to a protein's unique function?​

Answers

Answer:

Once assembled, what is the key to a protein's unique function? The manner in which proteins fold is the key to their function

The endoplasmic reticulum is an important  region where protein folding occur. Because proteins need to be appropriately folded into distinct structures, this is an essential biological function.

What is importance of protein folding?

Proteins that are misfolded or are unfolded improperly impart to the pathophysiology of many illnesses.

Protein folding is a highly delicate process that is regulated by a variety of external stimuli, such as temperature, pH, chemicals, molecule crowding, electric and magnetic fields, and temperature.

These elements affect a protein's capacity to fold into the appropriate functional forms.

Therefore, Protein folding give unique properties to protein functions.

Learn more about protein folding here:

https://brainly.com/question/28421475

#SPJ2

If a cell suddenly stopped producing transfer RNA, which of the following processes would be immediately affected?

Answers

Answer: DNA

Explanation: The RNA is a big affect on the DNA because, there will be no repairs of the DNA leading to cancer

1. What Does DNA stand for?​

Answers

Answer:

deoxyribonucleic acid

DNA stands for deoxyribonucleic acid.

What portions of RNA are cut out and discarded during the process of RNA editing

Answers

Answer:

 introns are portions of RNA that are cut out and discarded.

Explanation:

What are the advantages and disadvantages to produce few offspring that are extensively cared for and protected?

Answers

Advantages: Since they’re well cared for, they will grow up to be strong and hopefully produce healthy offspring.
Disadvantages: Fewer of them means that when one is lost, it will have a greater effect on the group. They also cannot reproduce as quickly as if they had lots of offspring.

Why do the cells used for reproduction only have half (½) of the DNA that other cells have?

Answers

Answer:

Because each chromosome has a pair, these cells are called "diploid" cells. On the other hand, human sperm and egg cells have only 23 chromosomes, or half the chromosomes of a diploid cell.

Explanation:

PLEASE HURRY I AM TIMED!!!
Are aliens real? Explain your answer.

Answers

Answer:

No, not according to any sciences (unless you mean aliens as in immigrants)

Explanation:

There is no way that we are the only living thing in the entire world. There has to be another species out there.  They might be wondering if there is another living thing out in space too.

the biotic factors of each land biome are determined by its ___
climate
organisms
location
size

Answers

Climate hope this helped

Answer:

climate

Explanation:

How many chromosomes would you expect to be in the daughter cells of the mosquito after mitosis? When starting with 6

Answers

Answer:

i think it would be 12 since during mitosis it creates identical daughter cells which doubles up cells.

Explanation:

Answer:

12

Explanation:

Which of the following are sources of extra nutrients that can cause algae to overgrow in water due to HUMAN activity? CAREFULLY select all options that apply. List the answers.


dissolved oxygen in water

treated waste water

viruses

combined sewage overflow (CSO)

fertilizers

cleaning products

dog poop on the streets of NYC

water running over rocks


(This is 7th grade science)

Answers

I’m not sure about the rest but I think Dog poop is one

How is the earthworm limited by being a skin breather?

Answers

Answer:

Earthworms need oxygen just like humans, but they don't have lungs like we do. They have a special skin that allows them to “breathe” oxygen right through it. ... This means the amount of oxygen inside the earthworm will always be less (lower concentration) than the area outside of the earthworm (higher concentration).

Answer:

It won't survive under water? mabye..... i don't think it sent the full question

How are herbivore and carnivore alike

Answers

Answer:

They both obtain energy by consuming other organisms.

Explanation:

Hope this helps<3

Answer:they both gather energy from other organisms.

Explanation:

In the seventeenth century, Francesco Redi performed experiments using raw meat placed in jars.
• Half of the jars were covered, and half were left open,
• Redi noticed that the meat in the sealed jars did not have maggots, but the meat in the open jars did have maggots.
Redi concluded that only flies could make more flies,
.
Which part of the cell theory corresponds to Redi's findings?

Answers

Answer: B

Explanation:

''New cells come from the existing cells'' is a part of the cell theory which corresponds to Redi's findings.

Experiment performed by Francesco Redi

Francesco Redi conducted an experiment in which he showed that living organisms come from other living organisms. This worked combine with the work of other later scientists, helped to develop the third part of the cell theory which is cells come from other living cells.

Learn more about cell theory here: https://brainly.com/question/3966602

What are some examples of nutrients that
circulate in blood? Check all that apply.
red blood cells
glucose (a simple sugar)
amino acids

fats

white blood cells

Answers

the answer would be all of them but fats so the top person is correct:)))

which layer of the earth is made out of melted metal?

Answers

The outer core. A molten nickle- iron alloy.

6B(SCIENCE) (6BB OOB)
4
What is the difference between evaporation and boiling? *
(1 Point)
A) There is no difference - they are exactly the same.
B) Evaporation, unlike boiling, occurs at all temperatures.
C) In evaporation, unlike in boiling, there is no state change.
D) In boiling, unlike in evaporation, the liquid volume reduces.
This question is required.​

Answers

B) Evaporation , Unlike boiling, occurs at all temperatures

Select the correct answer
Linda owns a great deal of land. She decides to rent her land to Andrea. However, she places certain restrictions on Andrea regarding the land use. Linda is using
which rights?
ОА. .
use rights
OB.
alienation rights
OC. management rights
OD. ownership rights

Help need answer ASAP !!

Answers

Management rights.

_______________________

How can agriculture cause soil pollution?

Answers

Agriculture pollution

Explanation:

Agriculture is a main source of pollution in lake water. chemical and fertilzer

Answer:

Pesticides and fertilizers used on crops fed to animals are a major contributor to land pollution

Explanation:

hope this helps :)

1)what organs make up the organ system , the circulatory system.


2)Bone tissue are shown on the left. what is the difference between tissue and specialized cells.

Answers

Answer:

1. Circulatory system is made up of your heart, arteries, veins and capillaries.

2. There isn't a photo attached. But Specialized cells perform specialized functions in multicellular organisms. Groups of specialized cells cooperate to form a tissue, such as a muscle. Different tissues are in turn grouped together to form larger functional units, called organs.

Explanation:

identify and explain three environmental impacts of current agricultural methods

Answers

Explanation:

It is profit making practice but it causes increased level of pathogens.

It has increased the level of chemicals in our land and water.

It has increased levels of greenhouse gases in air.

Other Questions
What is the answer to question 7, NH4C2H3O2 what country has not experienced balkanization? PLS HELP FAST, IM FAILING LOLWhat is true about life under slavery?A. Slave owners discouraged slaves from adopting elements of whitecultureB. Slave owners did not pay slaves for their work,c. Enslaved African Americans had equal rights to those of whitepeopleD. Slaves had a great deal of freedom other than choosing where towork. NEED HELP ASAP DUE 11:30PM ! Which descriptions of the English colonies in North America are accurate?Choose all answers that are correct.Question 46 options:The king granted a lot of self-government to Massachusetts and other colonies in the hope they would send back raw materials and would start paying taxes.The men on the Mayflower signed an agreement to write fair laws for the good of the colony.Virginia planters paid English laborers good wages to come work on their plantations.Jamestown was established on good ground near clean water in a healthy environment.Only about 1 in 5, or 20 percent, of early colonists in Virginia survived Match the expression with an equivalent expression 6( n + 4 ) = Can anyone please help me solve this?? A: x/8=3/4B: 2/5=x/40C: 1/8=x/40D:x/10=12/15 How are modern maps and ancient maps similar?a.They both feature three-dimensional drawings.b.They both rely on art and science for mapmaking.c.They both rely on paper-based drawings of an area.d.They both focus on the physical features of an area. 3(2(8-2x4)+25divided by 5 )-(2(8 divided by 4x2)-7(7-2x3) Calculate the volume of 1280 kilograms of aluminium if the density is 2700kg/m3 can you please help me:) What is a central idea in the Newsela article "Washed-Up Plastics Become Art with a Vital Message"?Children enjoy the art displays of sea creatures.Many people now look for trash to pick up when they are visiting the beach.Creating artwork can be both beautiful and horrifying.Increased awareness of the dangers of ocean pollution are creating interest in Pozzi's art.Question 2Part BWhich detail from the text best conveys the answer in Part A?"'It's the only thing he's liked all day,' his grandmother said.""An army of about 10,000 volunteers in Oregon help her collect, prepare and assemble the beach trash into art.""All of the art is made from plastic trash that washed ashore, including a great white shark""She now has more than 70 pieces in three exhibitions currently traveling throughout the United States. She also has requests from overseas." Please help 4 questions for 10 points!!!------------------------------------------------------------1) Which expression is equivalent to 4(23)?4(20+3)4(2+3)4(2+13)4(20+30)..................................................................................................2. Which expressions are equivalent to 4(42)?Select each correct answer.4(20+22)4(40+2)4(4+20)4(4+2).......................................................................................................3.Which expression shows how 645 can be rewritten using the distributive property?640+6206+205640+6564+65...............................................................................4.Tori uses the greatest common factor and the distributive property to rewrite this sum:24 + 84What expression does Tori write?2(24+42)12(2+7)24(1+4)4(6+21).....................................................................my last one got deleted.... paid rent of Rs.25000 by cheque. make journal entry Use a number line to order the numbers from least to greatest. HELLLPPPP!!!!! write the code for RNA from this DNA STRAND :AAAAAATTTTTTCCCGGGGTTTATATATC RIP grandsonhow does earths crust change earths surface [2.1 + (9.2 x 3.3)] x 0.8 PLEASE HELPPFill in the blanks in the following sentences with the logical word(s). Pay attention to the pronunciation.Spell out the following numbers in french: 1. 200:2. 256:3. 987:4. 875:5. 435:Based on the context, fill in the blanks in the following sentences with either the logical word or the appropriate forms of voir or croire. Say the whole sentence aloud.6. Est-ce que tu crois________Paul va aller au cinma ce soir?7. Elles_________les pommes sur la table.8.________vous aux fantmes?Oui! Vous_________ce fantme, l! Mais non, je ne le___________pas! Name the factors in each of the following problems