how social media can affect self esteem​

Answers

Answer 1

answer and

Explanation:

Social media can have both positive and negative impact on ones self esteem. The positive aspect can be that it may help a person feel less lonely and more valued, further allowing the person to feel better about themselves. As for the negative aspect, social media may play a role in giving a person a false perception on how they should look or act, making the user feel self conscious and even confused, affecting their self esteem negatively.


Related Questions

the pros and cons of vaccine passports and past mandates for vaccinations. Do you think the corona virus vaccine passport or the vaccine itself should be mandated for social or educational gatherings? Why or why not?

Answers

Answer:

no it shouldnt

Explanation:

it shouldnt because it takes away your freedom

Which word can describe a persons gender identity
A. Asexual
B. Female
C. Intersexual
D. Androgynous

Answers

Answer:

Female

Explanation:

I took the test so You are good

pls answer this.
NONSENSE(REPORT)​

Answers

Advil/ibuprofens. They don’t require a prescription

An operating room (OR) team identified eight categories of factors that contributed to errors during surgical setup.

a. True
b. False

Answers

Answer:

true

Explanation:

I believe the answer is true

The phosphagen system provides an instant source of energy for up ?

Answers

Muscle movement's quickest and most potent generator of energy. Anaerobic metabolism is exemplified by the phosphagen system. It generates ATP from creatine phosphate (adenosine triphosphate, the chemical which provides energy for all body processes).

Effects of food insecurity

Answers

Answer:

food insecurity is associated with increased risks of some birth defects,  anemia,  lower nutrient intakes,  cognitive problems,  aggression and anxiety.

Explanation:

hope it helps

List three movements for which Relative angle at particular joint is important?
List three movements for which Absolute angle for body segment is important?
Explain your choices?

Answers

Explanation:

abduction/adduction

flexion/extension

internal lexternal rotation.

examples of intuitionism theory in health care​

Answers

Answer:

where as Moore thought that it is self-evident that certain things are morally valuable, Ross thought that we know immediately that it is our duty to do acts of a certain type.

Explanation:

What are lacteals?


a.
Gastric secretory cells


b.
Products of milk digestion


c.
Intestinal lymphatic vessels


d.
Products of colonic fermentation

Answers

Answer:

c. intestinal lymphatic vessels

4. Who are three (3) people in your support system that you can talk to about your problems?

5. When you had more freedom with schooling during this time, why is having time management skills important?

Answers

Answer:

Friends, Parents or a coach or mentor.

Careers of Physical education
explain broadly on them

Answers

Answer:

1.Athletics Coach

2.Health Teacher

3.Physical Education Teacher

4. Athletics Administration

5. Gym teacher

6.Fitness instructors

7. Group Exercise instructors

Explanation:

Several different career opportunities are available for individuals interested in a career in physical education or health education. Below are a few of the most common choices an online degree in education can help prepare you for.

Athletics Coach

Coaches in elementary and secondary schools teach students the basic rules of team sports, as well as proper form and techniques. They run practice sessions and manage the team during competitions or games with other teams.

Health Teacher

Health teachers teach students about various mental, physical, emotional and sexual health issues in a classroom setting. They provide information and lead discussions on topics such as nutrition, safe sex, tobacco use, drug and alcohol abuse, and medicine.

Physical Education Teacher

Physical education teachers, also known as PE or gym teachers, teach students the rules and motor skills necessary to participate in individual and team sports. PE teachers at elementary schools usually teach half-hour classes to various groups of students throughout the day, while teachers at secondary schools might teach fewer but longer classes.

Athletic Administration

Athletic administration programs also offer those who currently work in the field of sports a chance to broaden their knowledge and explore other career possibilities within the sports industry.

Gym Teacher

A gym teacher, also called a physical education teacher, instructs students on principles of fitness and health. Topics covered may include nutrition, well-being, and exercise.

Fitness Instructor

Fitness instructors may work with individuals or groups. They demonstrate and teach proper techniques when exercising or using gym equipment. These fitness professionals assist clients with cardiovascular workouts, strength training and stretching.

Group Exercise Instructor

By demonstrating proper technique, correcting participants and explaining the value of particular movements, group exercise instructors help individuals get the most out of their exercise experience.

What is filtration??​

Answers

Explanation:

The process of filtering or separating something from different particles is called filteration.

hope it is helpful to you

Answer:

It is process of filtering a substance…

Example: Any liquid substance…

This is ur answer…

Hope it helps u mate…

Please mark me as brainliest…

How would you define the responsibilities and privileges of a healthcare provider?

Answers

Answer:

Hospital privileges authorize medical practitioners for a specific practice of patient care in a specified healthcare facility. Privileges are granted to physicians based on their current medical credentials and previous performance.

Responsibilities: Consult with patients, discuss their health care needs, and offer advice. Diagnose illnesses and offer prognoses as required. Provide a medical service or perform a procedure depending on the patient's needs.

what can you do to protect yourself from such abuse on social media platforms ​

Answers

Answer: We can avoid abuse by trying to tell an older person what is happening, and know how to avoid it. For example, you could block the contact, and sue the abuser.

Cannot avoid abuse………..

The Iron Triangle depicts the idea that, in healthcare, as we move towards one side of the triangle, we move towards the other sides as well. For example, high-quality healthcare will likely be very accessible and very affordable.

Answers

Answer:

False

Explanation:

In healthcare, the concept of the Iron Triangle was proposed by William Kissick (1994), who indicated that healthcare policies have to face an important challenge. This challenge describes the complex relationships between three fundamental factors that form part of any health care system: quality, access, and costs. These three factors have the same priority, and the rise of one factor directly influences one or both remaining factors (i.e., we can not simultaneously improve quality, cost and access in a health care system). In consequence, the better association in a health care system is given by high access, high quality, and low costs.

Julie's boss just gave her a new project with a deadline in one week. Julie views this as a challenge and works hard to finish the project on time. She's most likely experiencing what kind of stress?

Answers

Answer:

Eustress

Explanation:

Julie's boss gave her a new project that has a deadline. This work is challenging for Julie. So, she's most likely experiencing eustress.

What is eustress?

Eustress is a type of positive stress that is good for the health. It creates motivation and emotional well-being. It motivates us to do such works which are hard but have to do it.

Stress is a physiological change that increases the biochemical process of the body. It gives us excitement and happy fear. An example is when watching a scary movie.

Julie has work given by his boss, which she finds challenging, she wants to work hard to finish the project. She will have positive stress to complete the work on time, which is eustress.

Thus, Julie's most likely experiencing eustress.

To learn more about eustress, refer to the link:

https://brainly.com/question/1449392

#SPJ2

3.related to diagnostic procedures of the muscular system

Answers

Answer:

Electromyogram (EMG)

Explanation:

EMG is a procedure used to record electric activity in a muscle. This procedure is done to diagnose carpal tunnel syndrome. Electromyography is an electrical recording of activity in a muscle.

What happens to a person's center of gravity once they achieve a proper athletic stance? The center of gravity will

Answers

Answer:

the center of gravity will shift

Explanation:

Every single body and thus the athletes themselves, is made up of individual components each of which has its own weight. ... So if the same body is to take a different shape, the position of the center of gravity will shift. An athlete that bends his/her legs will lower his/her center of gravity position.

The center of gravity will shift as a person's center of gravity once they achieve a proper athletic stance.

What is center of gravity?

The average location of an object's weight is known as its center of gravity.

Any object's travel through space may be completely explained in terms of how its center of gravity moves from one location to another and, if it is free to spin, how it rotates around that center of gravity.

Balance and stability in sports are improved by lowering the center of gravity.

Because of this, bending your legs and lowering yourself to the ground allows you to change directions more quickly. Because of the increased stability, you can adapt to the legs producing more force.

Thus, the center of gravity will fluctuate accordingly.

For more details regarding center of gravity, visit:

https://brainly.com/question/20662235

#SPJ2

According to your textbook
Select one:
a. all motivation comes from the desire for external rewards
b. today's motivation researchers emphasize the biological drives that
guide behavior
c. human motivation is based entirely on psychological goals, not
biological needs
d. drive theories do not account for the full complexity of human
motivation

Answers

Answer: desire

Explanation:

interview three persons and find out what healhh products are they using also ask them why they are using those products?​

Answers

Answer: I'm assuming you want to interview us?

I can give you three health products I use (Not sure what products you want listed but here are mine)

1. Lactaid

2. Gas-X simethicone

3. Claritin D

Explanation: I use Lactaid because I'm lactose intollorent and it happens to help when I eat cheese. I use Gas-X to help when I'm bloating from eating cheese. And lastly I use Claritin D because I have bad pet allergies and it helps me stop itcvhing and sneezing when petting my cat.

I hope this somewhat helps you!

Fish, poultry, lean meats, and nuts should be consumed for which of the following nutrients?
A.
calcium
B.
carbohydrates
C.
protein
D.
vitamin D

Answers

D) is the answer your welcome

is the government doing enough to protect human rights??​

Answers

Answer:

currently, yes, biden just passed a discrimination law saying if youre an owner if a store/restraunt you are not allowed to discriminate and not help someone based off of their sexual orientation or gender identification.

Explanation:

i just read something that said freckles are bad, as in unhealthy. Is this true....?​

Answers

Answer:

No

Explanation:

freckels are natrual and some may not like how they look but can be really pretty freckels are not bad

What is the difference between a counselor and a social worker?

Answers

Answer:

The main difference between social worker and counselor is that a social worker is a professional who aims at alleviating the conditions of people who are in a mental, physical, economic, or social disadvantage whereas a counselor is a professional who aims at giving psychological assistance to people.

Explanation:

Brainlest?

Answer:

Counselors often work with families and individuals who are dealing with a specific set of issues, such as patients with mental health issues. Social workers, on the other hand, operate in social service systems to provide a broader range of services. Counselors usually specialize on one type of assistance.

Explanation:

Segundo Mendonça et al . (2016, p. 680), o profissionalismo surgiu como uma competência essencial para os profissionais da área da saúde no mundo. Ele se “[...] reflete nas atitudes, comportamentos, caráter e padrões de prática adequados, personificados por meio da familiaridade com os códigos de ética [...]”, por exemplo. É um ideal dos profissionais cujo compromisso é o alcance de níveis de cuidados em saúde de qualidade. MENDONÇA, E. T. et al . Avaliação do profissionalismo em estudantes da área da saúde: uma revisão sistemática. Interface - Comunicação, Saúde, Educação , Botucatu, v. 20, n. 58, p. 679-690, 2016. Disponível em: https://www.scielo.br/pdf/icse/v20n58/1807-5762-icse-1807-576220150274.pdf. Acesso em: 2 jul. 2020. Sobre o significado de profissionalismo, assinale a alternativa correta. A definição de profissionalismo abrange todo profissional que, independentemente de suas condutas imorais, obedece ao código de ética deontológica. O bom profissional é sinônimo de profissionalismo, ou seja, apenas deve conhecer e seguir o código de ética deontológica de sua profissão e aplicá-lo na rotina de trabalho. O profissionalismo significa seguir o código de ética deontológica de sua profissão e aplicá-lo na rotina de trabalho, ainda que o profissional possua comportamentos inadequados. O profissionalismo é o nível de competência suficiente para uma boa atuação profissional, com condutas cercadas de respeito e bom senso, por meio de indivíduos treinados para a realização de um bom trabalho A definição de profissionalismo é limitada ao indivíduo com boas condutas morais, que se aperfeiçoa em sua profissão, e, independentemente de condutas imorais, segue ao máximo o código de ética deontológica.

Answers

Answer:

O profissionalismo é o nível de competência suficiente para uma boa atuação profissional, com condutas cercadas de respeito e bom senso, por meio de indivíduos treinados para a realização de um bom trabalho

Explanation:

Por que você sabe que deve ser assim e as outras respostas possuem incoerências.  

How long do I have to stay up late to get sick?

Answers

Answer:

staying up late wont get you sick

this to do with you health will make you sick

Explanation:

Which hygiene practice can help prevent spreading a cold?

A washing your hands regularly

B cooking food thoroughly

C taking a fever reducer

D brushing and flossing your teeth

Answers

A washing youre hand regularly :)

zinc and iodine micronutrients

Answers

Answer:

Yes.

Explanation:

Yes, Zinc and iodine are micronutrients that need by our body in a very low amount as compared to other nutrients such as protein, carbohydrates, and fat etc which are considered as macronutrients because our body needs it in very large amount. Zinc, a mineral that people need to stay healthy which helps the immune system to fight with bacteria and viruses. The body also needs zinc to make proteins and DNA as well as the genetic material in all cells. Our body needs iodine to form thyroid hormones that control the metabolism of our body.

When developing a clients training plan, the entire training cycle is referred to as which of the following

Answers

Answer:

A macrocycle is the period of time that encompasses the entire training period, but is usually limited to no longer than one year.

Explanation:

Which of these describes a possible sexual orientation?

Answers

Answer:

A... the answer is a

Answer:

heterosexuality

Explanation:

that is being straight

Other Questions
Suppose that the speeds of cars travelling on California freeways are normally distributed with a mean of miles/hour. The highway patrol's policy is to issue tickets for cars with speeds exceeding miles/hour. The records show that exactly of the speeds exceed this limit. Find the standard deviation of the speeds of cars travelling on California freeways. Carry your intermediate computations to at least four decimal places. Round your answer to at least one decimal place. Express this sense sequence as a polypeptide. Use the three letter abbreviation and separate the amino acids with a dash - e.g. Trp-Thr-Ala. If there is a stop codon - you may add an asterisk to the sequence - e.g. Trp-Thr-Ala-* ATTTTAGCCATGCCCGGGAAAATACGCCGCCCTCCCGGTACACCATTGTTCGGCAAATAAAAATAAAAT polypeptide sequence [answer1] what is the DNA sequence of the 5' UTR? [answer2] what is the RNA sequence of the 3' UTR [answer3] Please help!!!hi,can you please help me with this?thanks Help Me please!!!!! Rn calculate the mass in 4.05*10^22 molecules of calcium phosphate Which event is inferred by most scientists to be responsible for a climate change that has recently led to a decrease in the size of most glaciers? * a decrease in the rate of divergence of lithospheric plates along a mid-ocean ridge O a decrease in the amount of insolation reaching Earth's surface an increase in the amount of greenhouse gases in Earth's atmosphere an increase in the amount of vegetative cover in the tropics How is an ammeter connected in a circuit to measure current flowing through it? A skier of weight 700 N is pointed down a ski hill that has a slope angle of 25 above horizontal.What is the component of his weight pulling him down the slope.O 634NO 326NO 296NO 700N The following is a comprehensive problem which encompasses all of the elements learned in previous chapters. You can refer to the objectives for each chapter covered as a review of the concepts.Note: You must complete part 1 before completing part 2.Based on the following data, prepare a bank reconciliation for December of the current year:a. Balance according to the bank statement at December 31, $283,000.b. Balance according to the ledger at December 31, $245,410.c. Checks outstanding at December 31, $68,540.d. Deposit in transit, not recorded by bank, $29,500.e. Bank debit memo for service charges, $750.f. A check for $12,700 in payment of an invoice was incorrectly recorded in the accounts as $12,000.Enter all amounts as positive numbers.Kornett CompanyBank ReconciliationDecember 31, 2014SubtotalAdjusted BalanceDeductAdjusted Balance Simplify (2x^2 + 4x) - (7x - 3x^2 + 5) A shipping carton is in the shape of a triangular prism. The base area of the triangle is 6 inches squared and the the height of the prism is 15 inches. how many cubic inches of space are in the carton? Very tired1) The professor (teach)five classes Monday. He (be)afterward2) You (feed)the birds that we saw yesterday. Some of them (be)cardinals.first on the trail Saturday, because he (know)the way3) Andy (go)better than we did.4) The house (be)dirty after they left. We (clean)it yesterdaythe motorcycles in the garage, then they (eat)5) The boys (put)lunch6) My friends and I (find)some gold in the river. Then we (look)formore.7) 1 (like)to write poetry when I (be)eight years old.8) Charlotte and I (see) lightening in the sky Thursday night; the storm (come)fast.9) The children (go)to the park yesterday. They (stay)for two hoursoutside after it (snow)Three inches of snow (fall)10) We (play)that dayI need to past simple tense?? does anyone know the quotient of x and y Dichotomous key (PLZ HELPLPP) Chrysanthenone is an unsaturated ketone. If Chrysanthenone has M+ = 150 and contains 2 double bond(s) and 2 ring(s); what is its molecular formula? Enter the formula in the form CH first, then all other atoms in alphabetical order; do not use subscripts. The formula is case-sensitive. someone help me pleaseeeeee Which of the following describes the end behavior of the function (x) = 5x3 + 3x2 + x 9?A) As x , y + and as x +, y B) As x , y and as x +, y +C) As x , y and as x +, y D) As x , y + and as x +, y + ASAP WILL MARK BRAINLIEST! NO LINKS PLEASE ,DUE IN 5 MIN! Using an order of magnitude analysis, estimate the total textbook expenditures incurred by all engineering majors at National University per year what does the pair of happy and sad masks symbolized