Answer:
Without the skeletal system holding the body together and supporting structure, the muscular, cardiovascular, and urinary systems would be crushed under the impact of our body mass.
Explanation:
What does the prefix "hetero-" mean?
A. Same
B. Different
Answer:
B. Different
Explanation:
PLEASE HELP I WILL GIVE BRAINALIST
Answer:
DNA is double-stranded, but only one strand serves as a template for transcription at any given time. This template strand is called the noncoding strand. ... In most organisms, the strand of DNA that serves as the template for one gene may be the nontemplate strand for other genes within the same chromosome.
Answer:
35. I think ture
36 . true
37.i think False
38.T but it is complementary base pairing
39.
40.you have to use amino acid table for this
The template strand for a new DNA molecule reads 5' CCTGAATT 3'. What will be the nitrogen base sequence for the complementary strand created during DNA replication?
Answer:
3' GGACTTAA 5'
Explanation:
because Adenine always pair with Thymine and Cytosine with guanine. u can also remember them as Apple Tree and Car Garage
Because it is ______ , fermentation _______ oxygen.
Answers:
aerobic/requires
anaerobic/requires
aerobic/does not require
anaerobic/does not require
Answer:
anaerobic/does not require
Explanation:
anaerobic occurs in the absence of oxygenWhich of the following best represents the purpose of fertilizers?
Answer:
Fertilizer, natural or artificial substance containing the chemical elements that improve growth and productiveness of plants. Fertilizers enhance the natural fertility of the soil or replace the chemical elements taken from the soil by previous crops.
A single species can feed at only one tropic level
True
False
Answer: True sorry if I’m wrong.
Explanation:
Answer:
True
Explanation:
What are the non-living components of an ecosystem?
write a short story on the journey of a sperm cell seeking to enter in a egg cell to share life together as a zygote and beyond
(See the attached picture)
Direction: Write a short story on the journey of a sperm cell seeking to enter in a egg cell to share life together as a zygote and beyond.
Answer:The goal of the sperms’ journey to the egg is to fertilize it. To do so, the sperm cell must pass through a long and challenging path. This is one of the reasons why the total number of motile sperm cells is very important, and a key parameter for a man’s potential to reach pregnancy with his partner.
The sperms’ journey to the egg begins with millions of sperm cells that are released into the female reproductive tract during intercourse. The sperm cells gain their full ability to swim when they are ejaculated into the reproductive tract.
Upon ejaculation, the sperm cells are enclosed in a fluid called seminal plasma or semen, which is a mix of fluids from the testes, seminal vesicles, prostate, and the bulbourethral glands. The fluid contains elements which protect the sperm cells during their journey towards the egg. The semen thickens and helps the sperm cells stay inside the woman – as close as possible to the cervix, which is the “gate” to the egg.
Liquid extends from the cervix, allowing the sperm cells from the semen to swim into the cervix. Only the strongest sperm cells will make it this far. Once through the cervix, the sperm cells swim across the uterus and into the fallopian tubes.
I hope it helps!!The sperm cell fertilizes the egg and forms a zygote, which is further divided into multiple cells and becomes a child. The division is the process of mitosis that takes place from the zygote to the child's development.
How is the zygote formed and developed?The sperm and the ovum are produced by the process of meiosis from the male and female, respectively, and when both fertilize, the zygote is formed. The fertilized zygote is a single cell, but later that cell is further divided mitotically and forms a morula, then a blastula, and then the gastrula.
The cells of the gastrula undergo cell differentiation, different organs are developed, and the baby is finally formed. The child then continues to grow in size, and different organs grow and form the mature organ system. After a certain age, the reproductive organs start to mature and are capable of forming the gametes.
Hence, all of these events occurred from the zygote to the child's maturity.
Learn more about the zygote here.
https://brainly.com/question/465851
#SPJ2
i need help with this question
99% of the GMOs on the planet are ____
or ____
Answer:
The answer would be pesticide producers and herbicide resisters.
Explanation:
Hope this helped!
If y'all know science can y'all do dis, it's a multiple-choice question
' What is the net force required to give a box of mass 5 kg an acceleration of 4 m/s2 ?'
The answer to the question is
The number 20.
Hope this helps you. Sorry if i am wrong.
Explain how different types of cells help organisms live and grow?
Different types of cells have different jobs that are necessary to keep organisms alive.
Different types of cells are only found in specific types of organisms.
Cells are necessary in order for all organisms to grow big and hunt for their food source.
Cells provide support for all organisms to be able to move.
Answer:
Different types of cells have different jobs that are necessary to keep organisms alive. And cells also give the living animal more support. They also hold the genetic information of that organism in their nucules. This is with most cells but bacteria cells do not contain nucules.
Which of the following best describes the function of the human nervous system?
Answer:
The nervous system gathers, interprets, and responds to information about the body's internal and external environment.
HELP!!!
The tissues that develop from
of a zygote are the direct result of:
a. Meiosis and fertilization
B. Fertilization and differentiation
C. Asexual reproduction and meiosis
D. Differentiation, later,
Fertilization
Answer:
D. differentiation, later, fertilization
What elements are in the most common substance in the human body?
A. Carbon and nitrogen
B. Hydrogen and oxygen
C. Oxygen and phosphorus
D. Calcium and nitrogen
which process produce two genetically distinct haploid cells
Answer: mitosis
Explanation:
is eczema recessive or dominant? explain why or how.
Answer:
When caused by CARD11 gene mutations, atopic dermatitis has an autosomal dominant inheritance pattern , which means one copy of the altered CARD11 gene in each cell is sufficient to cause the disorder.
Explanation:
pls mark brainlest
WILL IVE BRAIN?? Why might humans not have widespread regeneration abilities?
Answer: because mammals have more complex biological structures; limb regeneration would require sophisticated controls to ensure that limbs and organs don’t grow out of control.
Explanation:
If earth’s atmosphere is made up of 78% nitrogen, why is nitrogen a limiting factor for producers?
A.
Consumers respire all of the available nitrogen.
B.
Nitrogen is unusable in its liquid form.
C.
There are more plants than gaseous nitrogen.
D.
Nitrogen is unusable in its gaseous form.
Identify what holds DNA, the hereditary information of a cell?
(Its not the nucleus)
PLEASE HELP!
Answer:
chromatin network or chromosomes
Summary of human nutrition
Answer:
Human nutrition is the process of which substances are Transformed into tissues and energy which are used up to mental and physical activities!
Each Taxonomy (category) gets less and less specific as they go further down the list.
A. True
B. False
Answer:
B. False
Explanation:
The levels of classification, from broadest to most specific, include: kingdom, phylum, class, order, family, genus, and species.
Answer:
B. False
Explanation:
Taxonomy is the study of the general principles of scientific classification.
Express this sense sequence as a polypeptide. Use the three letter abbreviation and separate the amino acids with a dash - e.g. Trp-Thr-Ala. If there is a stop codon - you may add an asterisk to the sequence - e.g. Trp-Thr-Ala-* ATTTTAGCCATGCCCGGGAAAATACGCCGCCCTCCCGGTACACCATTGTTCGGCAAATAAAAATAAAAT polypeptide sequence [answer1] what is the DNA sequence of the 5' UTR? [answer2] what is the RNA sequence of the 3' UTR [answer3]
Answer:
- Protein sequence: Met-Pro-Gly-Lys-Ile-Arg-Arg-Pro-Pro-Gly-Thr-Pro-Leu-Phe-Gly-Lys-*
- DNA 5' UTR: ATTTTAGCC
- RNA 3' UTR: UAAAAAUAAAAU
Explanation:
Transcription is the process in which a DNA sequence (e.g., a gene) is used as template (transcribed) in order to synthesize an RNA molecule, usually a messenger RNA molecule, which is then used as template to produce a polypeptide sequence (protein) in the ribosomes. In RNA, Thymine (T) bases are always replaced by Uracil (U) bases. An mRNA strand is formed in the 5′ to 3′ direction. Each triplet of nucleotides is referred to as a codon and the resulting mRNA strand is translated starting from codon AUG (Methionine), while there are three different stop codons or 'or termination codons' in the genetic code that terminate translation: UAG, UAA, and UGA.
What is photosynthesis
CARRYONLEARNING(◕ᴗ◕✿)
The skull and vertebrae are part of the _________ in vertebrates. circulatory system endoskeleton nervous system exoskeleton Science
Answer:
Endoskeleton
Explanation:
Hope this helps!
Answer:
nerveos systum i think is tha anser
The diagram above illustrates the carbon cycle. Which of the Following components of the diagram represent carbon sinks?
A. marine photosynthesis and respiration
B. volcanoes and soil carbon
C. oceans and fossil carbon
D. factories and photosynthesis
Answer:
D) Factories and Photosynthesis
Mr. and Mrs. Green have a daughter, Georgia, who was born at Riverside Community Hospital. Mr. and Mrs. Blue have a daughter, Belle, who was born on the same date at the same hospital. Mrs. Green, having recently seen Belle, is convinced that Belle and Georgia had been assigned to the wrong parents at the hospital. Mrs. Green thinks that Belle is her biological daughter. ABO blood analysis was performed on all individuals involved:Mr. Green: Type AMrs. Green: Type A Georgia: Type AMr. Blue: Type ABMrs. Blue: Type ABelle: Type O
Is Mrs. Green correct? Is Belle her biological daughter? Explain.
Answer:
Yes, Mrs Green is correct that Belle is her biological daughter
Explanation:
According to this question, Mr. and Mrs. Green is said to have a daughter, Georgia while Mr. and Mrs. Blue is said to have a daughter, Belle. Both daughters were born the same day. Hence, a controversy occured as Mrs. Green thinks that Belle is her biological daughter.
Based on the blood analysis, the following were obtained:
Mr. Green: Type A
Mrs. Green: Type A
Georgia: Type A
Mr. Blue: Type AB
Mrs. Blue: Type A
Belle: Type O
The genotype of the following blood types is as follows:
Type A - iAiA or iAi
Type B - iBiB or iBi
Type O - ii
Type AB - iAiB
From the analysis of blood types of Mr and Mrs Green, which are both type A, they can possibly produce a child with type A.
However, from the analysis of Mr. and Mrs. Blue, it is impossible to have a child with blood type O. However it is possible for Mr and Mrs. Green if they are both heterozygous (iAi × iAi). The punnet square is attached. Hence, Mrs Green is correct about her claim since Mr. and Mrs. Blue cannot have a child with blood type A.
Starch is a polysaccharide used as a component of cell walls in plants.
True
False
Answer:
false
Explanation:
is type of carbohydrates
False. Starch is a polysaccharide used as an energy storage molecule in plants, but it is not a component of cell walls.
What are structural component of cell wall?Cell walls are structural components found in the outermost layers of cells in plants, fungi, and some bacteria. They provide support and protection for the cell, and are composed of a variety of different biomolecules, including cellulose, pectin, and lignin.
Starch, on the other hand, is a complex carbohydrate that is synthesized and stored in the cells of plants, particularly in the seeds, roots, and tubers. It is made up of long chains of glucose molecules and is used by plants as an energy source, particularly during times when the plant does not have access to light for photosynthesis. Starch is not a component of cell walls.
Learn more about cell wall, here:
https://brainly.com/question/965751
#SPJ2
Write mechanism of absorption
Answer: The mechanism for absorption is that a photon transfers all its energy to an electron in the absorbing material. The photon is "lost" from the light beam as it is absorbed in a single event. The electron is excited by the gain in energy to a higher energy state in the electron configuration around the atom. (hope it helps)
Answer: I don't know
Explanation: i am brainless
two types of global food webs show the feeding relationships of organsms. What distinguishes one type of global web from the other?
A whether the producers are located on land or in water
B whether or not the food web includes tertiary consumers
C whether the web includes animals that migrate during the year
D whether the ecosystem described by the web is localized or very broad
Answer:
A. wheter the producers are located on land or in the water.
