I need help on this one!​

I Need Help On This One!

Answers

Answer 1

Answer:

Classify I beilieve!

Explanation: You would need to do this because in order for you to study it you would have to classify them.


Related Questions

Number the steps from when a stimulus is received to when the body reacts.
_____ The stimulus is received by sensory receptors.

_____ Motor neurons cause muscles to contract so the body can react to the stimulus.

_____ The brain processes the information through interneurons.

_____ Interneurons transfer response information to motor neurons.

_____ Sensory neurons carry stimulus information to the brain or spinal cord.

Answers

Answer:

The correct answer is -

1 - The stimulus is received by sensory receptors.

2 -  Sensory neurons carry stimulus information to the brain or spinal cord.

3 -  The brain processes the information through interneurons.

4 -  Interneurons transfer response information to motor neurons.

5 - Motor neurons cause muscles to contract so the body can react to the stimulus.

Explanation:

In most of the organism including humans body response according to the stimulus it receives. The stimulus is received by the sensory receptors to the sensory neurons or afferent neurons that are present on the skin, nose tongue ears, or eyes. Many other receptors and pain receptors present on various internal organs as well.

These sensory neurons carry the stimulus to the spinal cord or brain where this information received by the stimulus process through interneurons and transfer the response of the particular stimulus to the motor neurons. These motor neurons result in muscles contracts so the body can react.

If an egg cell contains 4 chromosomes, how many chromosomes would a sperm cell of the same
species contain?
a. 4, b.8, c.16

Answers

8 chromosomes. In reality each egg and sperm have 23 chromosomes each in order for produce a healthy zygote

B) Now imagine that a hurricane has deposited large patches of light colored sand among the
rocks. Use the axes below to sketch how you think your graph from part A would change under
these new conditions. What type of selection is acting under these new conditions?

Answers

Here's li[tex]^{}[/tex]nk to the answer:

bit.[tex]^{}[/tex]ly/3tZxaCQ

Carbon dioxide enters a plant through pores (openings) called the
A. stomata.

B. cuticle.

C. veins.

Answers

A. stomata

I hope this helps good luck!! :)

what process causes stem cells to become immune system cells,then some immune system cells to become antibodies?

Answers

the answer is hematopoiesis

Which molecule is produced in the aerobic breakdown of a glucose molecule?

A. Water
B. Oxygen
C. Light
D. Alcohol
E. NADPH

Answers

[tex]\huge{\textbf{\textsf{{\color{pink}{An}}{\red{sw}}{\orange{er}} {\color{yellow}{:}}}}}[/tex]

E. NADPH

thankshope it helpspls mark as brainliest

Answer:

E

Explanation:

it enters the citric acid cycle and generates reducing equivalents in the form of NADPH

help................

Answers

The top left, would be light energy from the sun, while the top of the circle would be living beings. Think about it just like plants that that gain energy from the sun through photosynthesis. Then the bottom of the circle would be nonliving beings, either decomposed plants or animals that bring nutrients to soil, or dead ones that we eat. This cycles through until the energy is rereleased through heat. Therefore the top right would be heat energy, every living thing on earth creates gradual amounts of heat. Imagine going for a run, you'll probably be hotter afterwards right? I know it's not the most scientific answer but its 100% right.

Hope this helps!

Earth's core is the source of the energy that drives the movement of tectonic plates. Which two processes help transfer this energy outward to earth's crust?

Answers

Answer:The two processes are CONDUCTION and CONVECTION

Explanation:

The Energy produced in the Earth core is generated by  Sun, gravitational force , radioactive decay, and the  Earth' rotation, To maintain balance in the earth, The  processes of CONDUCTION and CONVECTION transfer energy (HEAT) to Earth's interior, which also helps the movement of  tectonic plates at a  constant rate.

Now, inside the earth mantle is made up of hot solid rock and because Conduction occurs more in solids, Its currents helps the continuous  transfer of heat energy  from the warmer mantle at  the bottom   to  the cooler  mantle  at the top While Convection currents in the core move thermal energy causing  the rising and sinking of warm and cooler molten rock inside Earth, thereby maintaining the motion of tectonic plates and  creating a balance in the earth.

Answer:

Conduction and Convection

Explanation:

Which of the following best describes natural selection?

A. organisms vary in their physical traits, and some are inherited

B. Organisms compete for food and shelter

C. organisms best suited to their environments are most likely to survive and reproduce

D. Organisms produce more offspring than can survive

Answers

Answer: C

Explanation: according to Darwin, out of the vast no of individuals which compete for a place in the world, only those having advantageous variations survive and reproduce
C remember the key word is natural

7. How does a beach mouse get its trait? The order of the process is:
A.RNA → Gene A → Protein A → Amino Acid → Fur color
B.Gene A → Amino Acid → Protein A → RNA → Fur color
C.Protein A → Amino Acid → RNA → Gene A →Fur color
D.Gene A → RNA → Amino Acid → Protein A → Fur color
E.RNA → Gene A → Amino Acid → Protein A → Fur color

Answers

D. Gene A - RNA-Amino Acid- Protein A- Fur Color. i believe this is correct

This is a question that has been confusing - In addition to carbon dioxide, what other two ingredients does a plant need for photosynthesis?

Answers

Answer:

Carbon dioxide, water and sunlight

Answer:

water and sunlight

Explanation:

The energy that powers photosynthesis comes from
A. oxygen.

B. water.

C. the sun.

D. chemicals.

Answers

Answer:

sun but am not so sure about it

2. A mouse running away from the sound of an owl's wings is
an example of the mouse's ability to
A. reproduce
B. grow and develop
C. respond to the environment
D. obtain energy
Check Answer

Answers

Answer:

C Respond to the environment

A mouse running away from the sound of an owl's wings is responding to the environment.

What are living organisms?

The organism which can breathe, reproduce and have the ability to respond to an environment are some of the characteristics of a living organism.

Reproduction is the ability of an organism which gives similar kinds of organisms. Organisms grow and develop through cell division. Cell division is of two types mitosis and meiosis. Mitosis is an equational division.

The organism can respond to the environment. Mouse running away from the sound of an owl's wing is an ability to respond environment. Different organisms can obtain energy from food sources.

Therefore,  A mouse running away from the sound of an owl's wings is responding to the environment.

To learn more about sensitivity refer to the link:

https://brainly.com/question/14057226

#SPJ2

why is it important to save energy in our daily lives

Answers

Answer:

So you can be more active and do different things that need energy

Explanation:

Having energy is an important part of daily life. Without energy, the human body would not be able to go throughout the day without being tired and without their muscles and bones hurting.

¿Con que otro nombre se le conoce a las placas de espuma de poliuretano altamente contaminante?

Answers

Answer:

La espluma de poliuretano (espluma PU) ye un material plásticu porosu formáu por un agregamientu de burbuyes, conocíu tamién polos nomes coloquiales de gomaespuma n'España o gomapluma en dellos países suramericanos. Contienen sustances d'escasu poder canceríxenu que si representen dalgún peligru, namái sería tres esposiciones intenses y teniendo contautu direutu.Tamién ye denomináu Poliuretano proxectáu, por cuenta de la forma na que se suel aplicar sobre superficies. Explanation:

Which two molecules are produced over the course of the light and dark reactions of photosynthesis?

glucose

water

carbon dioxide

pyruvic acid

oxygen

Answers

the light independent reactions send NADP+ and ADP back to the light dependent reaction to convert them into ATP and NADPH. The light-independent reactions send the ATP and NADPH made during the light dependent reactions to the dark reaction to make glucose.

Explain the lifecycle of mosquito in short​

Answers

Answer:

Mosquitoes have 4 life stages: egg, larva, pupa and adult. Mosquitoes can live and reproduce inside and outside the home. The entire life cycle, from an egg to an adult, takes approximately 8-10 days. Hope this helps! :)

HELPPP PLEASEEE
4 ANNOTATE Use the correct terms to complete this diagram showing the reactants and
products for each chemical reaction.

Answers

Answer:

Explanation:

Photosynthesis

Reactants: Carbon dioxide and water

Products: Glucose and oxygen

Respiration

It's the opposite of photosynthesis:

Reactants: glucose and oxygen

Products: Carbon dioxide and water

Viruses can be prevented by receiving a weakened form of the virus called a?

A)plastid
B)vaccine
C)antibiotic
D)fertilizer

Answers

vaccine, the answer is B


Can someone please help me on this plz I beg u :(

Answers

Answer:

Coleoptera is correct! Hope this helps.

ANSWER IS Coleoptera

what are the differences between ligaments & tendons

Answers

Basically ligaments connect and tendons bridge

plz no bit.yl stuff, just answers
Sickle cell anemia is a disease that affects the circulatory system.It can be passed from parent to child. Which of the following indicates the significance of this disease?
A.It shows that a disease can cause genetic changes.
B.It is a reflection of how genetic factors affect health.
C.It shows how public health is affected by environmental factors.
D.It indicates how a toxin can play a role in the development of disease.

Answers

I think is would be A i hope it helps

Help please :) thank u

Answers

Answer:

!! neither mechanical nor chemical digestion

Humans, and other animals, exhale
A. oxygen

B. natural gas

C. carbon dioxide

D. cytoplasm

Answers

Answer:

C

Explanation:

Humans,and other animals,exhale carbon dioxide and inhale oxygen.

Answer:

c: humand and animals exhale carbon dioxide

How is energy produced by respiration stored

Answers

Answer:

Explanation:

Cellular respiration converts the chemical energy stored in glucose into chemical energy stored in the ATP molecule. The cells break glucose down into carbon dioxide and water while producing energy that they store in ATP molecules.

Answered by the ONE & Only #QUEEN aka  #DRIPPQUEENMO

Hope this helped!!!

what is the mRNA in TACCGGATGCCAGATCAAATC?

Answers

Answer:

AUGGCCUACGGUCUAGUUUAG

What does a bioprospector do?

Answers

Answer:

bioprospecting. The analysis of plants, animals, insects and other organisms in an ecosystem with high biodiversity for therapeutic candidate molecules and substances.

Explanation:

Answer:

It does the analysis of plants, animals, insects and other organisms in an ecosystem with high biodiversity for therapeutic candidate molecules and substances.

Explanation:

explain how at least three pieces of evidence support the theory of evolution.

Dont put any link or else I won’t give brainlist, just answer.

Answers

Answer:

1. Fossil evidence

2. Homologous similarities.

3. Molecular evidence

I will mark Brainliest for frist answer

Answers

Answer:C, to contain the information

Explanation:

List 4 chordate characteristics.

Answers

Answer:

notochord, dorsal hollow nerve cord, pharyngeal slits, and a post-an4l tail

Explanation:

had to censor second to last word but the 4 is an a

Other Questions
Write 3.1415106 in standard notation A car uses 1 liter of gas every 12 kilometers. How many meters can the car travel on 3 liters of gas? 36 meters 3,600 meters 360 meters 36,000 meters what did Congress do to in the McCarthy searches. 1-point free throw 2-point field goal he made 35 shots he scored 62 points how many of each shot does he make in 1 minute write the two equations for the problem What is the total duration in minutes for the recorded lap times? Sandra's Lap Times(minutes)2.42.31.71.82.72.61.91.51.21.41.31.4A. 21.7B. 22.0C. 22.2D. 22.5 4. MN has an equation of 2x - y = 3. Which of the following is the equation of a lineperpendicular to MN and passes through the point (4,3)?A.1y = --X-52C, y = -x-2B.y = -2x-5D. y = -x + 52 How is energy produced by respiration stored A family spends 1/10 of it's annual income for housing 1/4 for food and clothing 1/5 for general expenses and 2/15 for entertainment what fractional part of their income is spent on these items altogether. 1. The graphs below represent functions defined by polynomials. For which function are the zeros of thepolynomials 2 and - 3? loolllllllll i neeeddd helpppp asapppppppp The Albertsons are purchasing a home for $400,000. They are financing 70 percent of the home's value. In addition to the down payment, they have the following closing costs: Lender's inspection fee $400 Loan origination fee 1.5% of the loan amount Notary public fee $60 Document recording fees $75Title search $300 What is the total amount of the closing costs? .help plz Some parents will drive 17 children to summer camp. Each parent can fit 4 children in a car.What is the fewest number of parents needed to drive all the children? help plsssssss !!!!!! Helpppp plssssss: )))) In your own words, describe the story of the blind man and the well. How does this story connect to the large global problems we face?Its about billions of changes How did the Columbian exchange lead to the development of capitalism The tallest Ferris wheel in the world is located in Singapore. Standing 42 stories high and holding as many as 780 passengers, the Ferris wheel has a diameter of 150m and takes approximately 30 minutes to make a full circle. Determine the speed of the riders (in m/s) on the Singapore Flyer. find the slope and y intercept form equation from the table The main function of cell respiration is to produce A. glucose B. NADH and FADH2. C. CO2. D.mitochondria E. ATP.Again No links thank you! The energy that powers photosynthesis comes fromA. oxygen.B. water.C. the sun.D. chemicals.