I need help with this ASAP

I Need Help With This ASAP

Answers

Answer 1

Answer: tissues, organs, organ system

Explanation:

goes from top to bottom


Related Questions

What is another type of clean energy?

Answers

wind energy is a clean energy source

When identifying the agent responsible for causing a disease, why is evaluation of colony morphology not enough?

Answers

Answer:

Some infectious diseases are distinctive enough to be identified clinically. ... Infections may be caused by bacteria, viruses, fungi, and parasites. ... Microbial Identification: Colony and cellular morphology may permit preliminary ... Diagnostic medical microbiology is the discipline that identifies etiologic agents of disease.

Explanation:

Microorganisms have antigens present on their surface, Antigen tests detect the presence of a microorganism directly so that doctors can diagnose an infection quickly, without waiting for a person to produce antibodies in response to the microorganism.

Evaluation of colony morphology is not enough as it is not a definitive test. colonies of different bacteria can look the same, so it can help narrow.

What is antigen tests?

An antigen test is an immunoassays test used for the detection of a specific viral antigen that indicates current viral infections.

Hence, Antigen tests detect the presence of a microorganism whereas, Evaluation of colony morphology is not enough as it is not a definitive test.

To learn more about the Antigen  click here

https://brainly.com/question/14453511

A planet has less mass than a galaxy and more mass than the star it orbits.
True
False

Answers

Answer:

False is your answer

Which process begins the formation of sedimentary rock?

Answers

Weathering breaks down pre-existing rock into particles, while erosion moves the particles to a site of deposition. These processes begin the formation of sedimentary rock. ... Sediment can be moved by wind, running water, ice, or waves.

what does the respritory system do?

Answers

Answer:

The respiratory system's main job is to move fresh air into your body while also removing waste gases.

Explanation:

Your lungs are part of the respiratory system, a group of organs and tissues that work together to help you breathe.

What is meant by trophic levels?

Answers

Answer:

The position it holds in the food chain

Explanation:

A food chain is a succession of organisms that eat other organisms and may, in turn, be eaten themselves.

People who have leukemia, cancer that affects white blood cells, are often given Cytarabine. This drug inhibits the synthesis of DNA. Which phase of the cell cycle is most affected by Cytarabine?

Answers

Correct answer is S phase. cytosine into cytosine arabinoside triphosphate is what makes the answer S phase.

mutations in dna may or may not result in a change in the phenotype of an organism. in which of the following situations will a mutation appear in the phenotype of an individual

Answers

Some mutations don't have any noticeable effect on the phenotype of an organism. This can happen in many situations: perhaps the mutation occurs in a stretch of DNA with no function, or perhaps the mutation occurs in a protein-coding region, but ends up not affecting the amino acid sequence of the protein

The type of mutation which may not result in any chage to the penotype of an organsim is called a silent mutation.

What are mutations?

Mutations refers to the changes that occur in the DNA of an individual organism. These chages may or may not change the appearance (phenotype) of the orgamsim.

The type of mutation which may not result in any chage to the penotype of an organsim is called a silent mutation.

Learn more about mutation:https://brainly.com/question/365923

PLEASE HELP!!!!
Photoperiodism is one example of how a plant responds to changing seasonal conditions. Why is it important for plants to be able to respond to seasonal changes?

Answers

Answer:

It is important because plants respond to light depend, logically enough, on the plant's ability to sense light. Phototropism is a directional response that allows plants to grow towards, or in some cases away from, a source of light. Photoperiodism is the regulation of physiology or development in response to day length.

A man and a woman have a child together. The mother's blood type is type O and the child's blood type is type A What could the father's genotype be?

Answers

Answer:

iAiA or iAi = Type A

Explanation:

Blood group in humans is controlled by a gene with multiple alleles. The alleles iA and iB are co-dominant over one another but dominant over allele i. In the blood type:

iAiA or iAi - type A

iBiB or iBi - type B

iAiB - type AB

ii - type O

According to this question, a man and a woman have a child together. The mother's blood type is type O (ii) and the child's blood type is type A (iAi). This means that the father's blood type must be a type A with genotype "iAiA or iAi".

true or false
Photosynthesis is part of an oak tree's niche.

Answers

Answer:

True, veryyyyy true

:))

Please help.................

Answers

Answer:

C i think.......................................

The energy from sunlight is directly used by the plant to
A. absorb carbon dioxide.

B. split water.

C. suck up water through the roots.

Answers

The energy from sunlight is directly used by the plant to :

=》split water molecules,

splitting of water molecules during photosynthesis is done by solar energy absorbed through chlorophyll.

How is information for a specific protein carried on the DNA molecule?
a. as a sequence of nucleotides
b. in the double helix shape of the condensed chromosome
c. in the ratio of adenines to thymines
d. as a pattern of phosphates and sugars

Answers

Answer:

b

Explanation:

Genetic information is carried in the linear sequence of nucleotides in DNA. Each molecule of DNA is a double helix formed from two complementary strands of nucleotides held together by hydrogen bonds between G-C and A-T base pairs. ... In eucaryotes, DNA is contained in the cell nucleus.

The information for a specific protein is being carried on the DNA molecule as a sequence of nucleotides. Hence, option (a) is the correct answer.  

Nucleic acids are of two types. They are namely deoxyribonucleic acid (DNA) and ribonucleic acid (RNA). DNA molecule carries the information for a specific protein. They are described as follows:

DNA is the genetic material of the cell  DNA molecules undergo a process called transcription to code for codons on mRNA strand These codons tend to pair with tRNA molecule which holds the amino acids The amino acids will then form a chain in the sequence of DNA nucleotides to result in protein formation  

Thus, we can conclude that the information for a specific protein is being carried on the DNA molecule as a sequence of nucleotides. Thus, option (a) is the correct answer.  

Learn more about DNA here:

https://brainly.com/question/264225

Which organelle of a cell functions similarly to the envelope of a virus and why?

Answers

Answer: linear or circular. include genes encoding viral proteins: capsid, envelope proteins, any polymerase not found in the host cell. viruses may have a lipid envelope.

Water that reaches the ground and moves horizontally towards rivers, streams, and lakes is called runoff.

A. True

B. False

Answers

Answer:

A. True

Explanation:

flow off a hill slope directly to a stream in the form of runoff, or it may flows downward through the unsaturated zone to reach the water table. The area at the stream or lake to which the groundwater is flowing. Recall that water is flowing in pores where there is friction, which means it takes work to move the water.

what is the mRNA in TACCGGATGCCAGATCAAATC?

Answers

Answer:

AUGGCCUACGGUCUAGUUUAG

Choose between Harmful, Neutral, or beneficial mutation for this problem. NO LINKS OR BAD ANSWERS OR YOU WILL BE REPORTED!!!!!!!!

Answers

Answer:

I choose beneficial mutation

Explanation:

_______ Which vitamins and minerals must be listed on food labels?
a. vitamin D, vitamin C, iron and magnesium
b. vitamin C, calcium, iron and potassium
c. vitamin C, vitamin A, calcium and iron

Answers

I believe the answer is C


Which statement below is NOT a statement within the Cell Theory?
A. all cells come from other cells
B. all organisms are composed of cells
C. the cell is the basic unit or organization of organisms
D. all cells contain DNA (genetic information)

Answers

The best answer to go with is b you’re welcome

i need help with #8, #10 please! whoever helps me, ill give brainliest <3

Answers


1. peripheral nervous system
2. synapse
3.nerve impulse

state and explain components of blood​

Answers

Answer:

It has four main components: plasma, red blood cells, white blood cells, and platelets. Blood has many different functions, including transporting oxygen and nutrients to the lungs and tissues

Explanation:

Plasma is the main component of blood and consists mostly of water, with proteins, ions, nutrients, and wastes mixed in. Red blood cells are responsible for carrying oxygen and carbon dioxide. Platelets are responsible for blood clotting. White blood cells are part of the immune system and function in immune response.

Thank you to anyone who answers .

Answers

Answer:

D

Explanation:

Answer:

i think its D but im so sorry if it wrong my second answer would probably be A

Explanation:

i really hope this helps sorry if it doesn't

mushroom can only be found in dark places . why ?

Answers

Answer:

advantage of growing mushrooms in the dark is that darkness preserves the moisture that mushrooms spores need to reproduc

How does air pollution affect human health?
a. Respiratory infections
b. Lung Cancer
c. Asthma
d. All of the Above

Answers

Answer:

The answer for this question is D

d is the correct answer

Which conclusion is supported by the fact that the black-breed boar, with its quality meat, and the white-breed sow, with its quality fertility, are swine that are often matched for mating? Animals are often paired based on physical traits and personal compatibility. Strong reproductive capability is the most important trait in animal breeding. Selective breeding combines ideal traits of animals to replicate in offspring. Swine are the only agricultural animal species that are currently crossbred.

Answers

Answer:

Selective breeding combines ideal traits of animals to replicate in offspring

Explanation:

Selective breeding is the process which involves choosing parents with particular characteristics to breed together and produce offspring with more desirable characteristics. It is also known as artificial breeding and provides both plants and animals with greater variation and higher chances of survival. Selective breeding can be used to produce plants with bigger and tastier fruits and vegetables, crops with greater resistance to pests and diseases, and bigger animals that can be used for meat or milk production. The process of selective breeding is of great importance to the farmer today as it has brought about greater economic advantages.

In the instance of the black-breed boar and the white-breed sow being matched for mating, the reason is to combine these desirable traits in their offspring. The black-breed boar produces quality meat while the white-breed sow has quality fertility. Mating between these two breeds will produce offspring which has both traits of quality meat production as well as quality fertility.

Consider the four organisms you see here. Each represents a specific kingdom. They all exhibit the characteristics of life. Think about
their life cycles. Compare and contrast the life cycles of the four. How do they differ?
es )

Answers

Answer:

Please where's the image of the question

Answer:

B

Explanation:

Both the animal and the plant exhibit stages of growth during their lifetimes. They have what mightbe described as a mature stage. The other two, protist and bacteria do not.

If a son has a sex-linked disorder, he received it from ______.

Answers

Answer:

tuff

Explanation:

if the son has a sex-linked disorder, the son received it from his mother

Someone suggested that everything to be sent to the base on the moon must be sterelized so that no bacteria of any kind are present.Do you think this is a good idea

Answers

Answer:

Yes.

Explanation:

Yes, it is a good idea by sterilizing everything because this sterilization process kills bacteria or other harmful microbes on the items and no chance of bacterial infection occurs in the base that is present on the moon. This sterilization process is very important in order to make the health of the crew members and scientists that lives in the base on the moon. If the bacteria or other harmful microbes enters in the base so its maintained environment will triggers its growth and infections in the humans so it is a good idea.

A father sheep has curly wool while a mother sheep has straight wool. Which of these statements explains why one of their baby lambs has curly wool?

Answers

Answer:

This means that the baby sheep received the same set of genes as the father sheep giving it curly wool.

Explanation:

This means that the baby sheep received the same set of genes as the father sheep giving it curly wool.

OR if the baby sheep received a mixed set of genes , one from father , the other from mother , the gene of the father is dominant over the gene of the mother and it has given the baby sheep curly wool.

During fertilization the baby must have received the same set of genes as those of its father. If the baby has received a mixed set of genes then the genes of the father are dominant over the genes of the mother resulting in curly wool.

The fathers gene may be dominant due to environmental circumstances or other factors.

Answer:

Explanation:The baby lamb inherited its copies of the gene for wool shape from its father and not from its mother. Just like its father’s genes, those genes instruct for proteins that connect in ways that make its wool curly.

Other Questions
state four reasons why human rights violation negatively impact on human dignity who is the first person to discover the periodic table Sarah Turned on the soaker hose in her flower bed. The hose releases 192 gallons of water every 4 hours. If she leaves the hose on for 30 minutes how much water will be used? what would happen if you gave your dog a tiny piece of chocolate? (1) In 1751, the Philadelphia Provincial Assembly had a bell made. (2) It was for the new State House. (3) The bell weighed more than 2,000 pounds. (4) The bell was 12 feet in circumference around the bottom. (5) It came to be known as the Liberty Bell because it was inscribed with a motto about liberty. (6) Unfortunately, the Liberty Bell cracked in 1752 during a test ring. (7) To fix the bell, the Philadelphia Assembly had it recast. (8) Some people say the bell cracked again in 1835. (9) It was tolling for John Marshalls funeral. (10) However, that is probably just a legend. (11) It is a fact that on February 22, 1846, the bell cracked again. (12) That crack could not be fixed. (13) The Liberty Bell has had a crack in it ever since. Which is the most effective way to combine sentences 8 and 9? A.Some people say the bell cracked again in 1835 while it was tolling for John Marshalls funeral.B, Cracked again in 1835, some people say while tolling for John Marshalls funeral.C. Some people say the bell cracked again in 1835 and was tolling for John Marshalls funeral.D. Although some people say the bell cracked again in 1835, it was tolling for John Marshalls funeral. I need help ASAP because I need done before 4:00pm What was the Marshall Plan? How did this contribute to tension between the U.S. and the Soviet Union? How would you decide whether or 5 or 595 is greater? In a sequence of numbers, a4=9, a5=13, a6=17, a7=21, and a8=25.Which equation can be used to find the nth term of the sequence, an?an=9n+4an=4n+9an=7n4an=4n7 . To buy a car, Mitchell borrowed $17,000 for 3 years at an annual simple interest rate of 9%. If it takes him 3 full years to pay off the loan, how much interest will he will pay for the car? * O $9,045 O $9,009,000 O $ $4590 O $459,000 2. Jaelyn deposits $750 into an account that yields 6.5% simple interest. How much will he in her account in 30 months if she door no 10 points The United States Congress may pass laws, and they go into effect if thePresident signs the law. However, the Supreme Court can declare the lawunconstitutional. This is an example of On August 2, Jun Co. receives a $6,300, 90-day, 12% note from customer Ryan Albany as payment on his $6,300 account receivable. 1. Compute the maturity date for the above note. multiple choice October 29 October 30 October 31 November 1 November 2 True or False: There are only 2 sets of conjugations in the Imperfect Tense. List some of the external problems that China faced during the 1800s. Explain the importance of the dome of the rock mosque in Jerusalem (A few)_______ apartamentosUnas LasLosUnos Why do the chromosomes line up in the middle of the cell Which of the following is equivalent to x 3/7 Why were factories able to force workers to endure these conditions? What circumstances caused these conditions to exist and allowed it to continue? (3 4 sentence answer) Jim bought some nice running shoes for $216. The salestax is 6.5% and he is paying cash with bills only becausehe doesn't have any change. What is the least amounthe should give the cashier?