I neeed help plsss hurry

Answer:

The respiratory system's main job is to move fresh air into your body while also removing waste gases.

Explanation:

Your lungs are part of the respiratory system, a group of organs and tissues that work together to help you breathe.

Answer:

1. Fossil evidence

2. Homologous similarities.

3. Molecular evidence

Answer:

1. rock

2. on

3. mantle

4. volcanoes

5. active

6. lava

7. hot

8. coolest

9. geyser

10. resistant

11. tectonic

12. tectonic/pangea

13. caves

14. earthquake

15. crust

Explanation:

Answer:

Yes.

Explanation:

Yes, it is a good idea by sterilizing everything because this sterilization process kills bacteria or other harmful microbes on the items and no chance of bacterial infection occurs in the base that is present on the moon. This sterilization process is very important in order to make the health of the crew members and scientists that lives in the base on the moon. If the bacteria or other harmful microbes enters in the base so its maintained environment will triggers its growth and infections in the humans so it is a good idea.

Answer:

Mosquitoes have 4 life stages: egg, larva, pupa and adult. Mosquitoes can live and reproduce inside and outside the home. The entire life cycle, from an egg to an adult, takes approximately 8-10 days. Hope this helps! :)

Answer:

The correct answer is -

1 - The stimulus is received by sensory receptors.

2 -  Sensory neurons carry stimulus information to the brain or spinal cord.

3 -  The brain processes the information through interneurons.

4 -  Interneurons transfer response information to motor neurons.

5 - Motor neurons cause muscles to contract so the body can react to the stimulus.

Explanation:

In most of the organism including humans body response according to the stimulus it receives. The stimulus is received by the sensory receptors to the sensory neurons or afferent neurons that are present on the skin, nose tongue ears, or eyes. Many other receptors and pain receptors present on various internal organs as well.

These sensory neurons carry the stimulus to the spinal cord or brain where this information received by the stimulus process through interneurons and transfer the response of the particular stimulus to the motor neurons. These motor neurons result in muscles contracts so the body can react.

Answer:

Coleoptera is correct! Hope this helps.

Answer: The metamorphic rocks can erode into sedimentary rocks which can turn into igneous rock. Metamorphic rocks in the rock cycle is driven by tectonic plates.

Explanation:

Answer:

compound

Explanation:

as cited from coolgalapagos.com, "Molecules made of more than one kind of element are called compounds. A compound is formed when one kind of atom (an element) joins to at least one other kind of atom of a different element."

Answer:

D. The reaction are too slow to meet the needs of the cell if enzymes are missing

hope it helps

Answer:

Carbon dioxide, water and sunlight

Answer:

water and sunlight

Explanation:

Answer: linear or circular. include genes encoding viral proteins: capsid, envelope proteins, any polymerase not found in the host cell. viruses may have a lipid envelope.

Answer:

I don't know

Explanation:

I don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowHow are primary and secondary ecological succession similar?

1 Both types of succession require the same amount of time to occur.

2 Both types of succession result in greater biodiversity over time.

3 Both types of succession decrease the stability of an ecosystem.

4 Both types of succession have the same starting conditions.

5 Both types of succession eventually lead to a community closer to equilibrium.

Hold on, our servers are swamped. Wait for your answer to fully load.

Answer:

b

Explanation:

Genetic information is carried in the linear sequence of nucleotides in DNA. Each molecule of DNA is a double helix formed from two complementary strands of nucleotides held together by hydrogen bonds between G-C and A-T base pairs. ... In eucaryotes, DNA is contained in the cell nucleus.

The information for a specific protein is being carried on the DNA molecule as a sequence of nucleotides. Hence, option (a) is the correct answer.  

Nucleic acids are of two types. They are namely deoxyribonucleic acid (DNA) and ribonucleic acid (RNA). DNA molecule carries the information for a specific protein. They are described as follows:

Thus, we can conclude that the information for a specific protein is being carried on the DNA molecule as a sequence of nucleotides. Thus, option (a) is the correct answer.  

Learn more about DNA here:

https://brainly.com/question/264225

Answer:

answer choice 4, more rain and a steeper slope cause it to flow faster

Explanation:

Answer:

the parents are (Tt) and each passed down the recessive allele so the child is  (tt)

Explanation:

Answer:

So you can be more active and do different things that need energy

Explanation:

Having energy is an important part of daily life. Without energy, the human body would not be able to go throughout the day without being tired and without their muscles and bones hurting.

Answer:

Formula: C5H10O4

Molar mass: 134.13 g/mol

Solubility in water: Very soluble

Melting point: 91 °C (196 °F; 364 K)

Appearance: White solid

Classification: Pentose, Deoxy sugar

Answer:

Please where's the image of the question

Answer:

B

Explanation:

Both the animal and the plant exhibit stages of growth during their lifetimes. They have what mightbe described as a mature stage. The other two, protist and bacteria do not.

Answer:

True, veryyyyy true

:))

Answer:

D

Explanation:

Answer:

i think its D but im so sorry if it wrong my second answer would probably be A

Explanation:

i really hope this helps sorry if it doesn't

Answer:C, to contain the information

Explanation:

Answer:

AUGGCCUACGGUCUAGUUUAG