if humans began hunting and driving the great barracuda to extinction how would this affect the ecosystem (answer should discuss biodiversity, food webs, and food chains)

Answers

Answer 1

Answer:

Generally considered to be the tertiary consumers (top level of the food pyrmaid), barracuda feed on an array of preys including grunts, groupers, snappers, small tunas, mullets, killifishes, herrings, and anchovies. By feeding on these marine organisms, barracuda prevent them from increasing in number.

Now let's barracuda's number starts decreasing due to hunting and other reasons. This will result in other primary and secondary consumers to increase in population. An increase in the number of primary and secondary consumers in the food chain will result in a decreasing number of plants, i.e. the number of producers decreases. Hence, this will negatively affect other connected food chains in the marine food web.

Explanation:


Related Questions

chromosomes_____ select all that apply
-always occur in pairs
-are tight coils of dna
-can be analyzed in a karyotype
-carry thousands of genes
-are carried on genes

Answers

Answer:

Are al

Explanation:

todos forman parte de las características de los cromosomas. Recuerde también que los cromosomas se encuentran en las células, específicamente en su núcleo.

Please Help.

What is the name of the process that plants use to remove carbon dioxide from the atmosphere?

1.) transpiration
2.) photosynthesis
3.) respiration
4.) decomposition

Answers

Photosynthesis is the answer

What is likely to happen to a healthy population that is experiencing exponential growth ?

Answers

Exponential growth refers to the increase in the growth of the population with respect to the time. The healthy population will likely to decrease after experiencing exponential growth because the carrying capacity of a region will not be able to sustain the growth of increase in number of individuals.

Meiosis plays a more significant role in reproduction than mitosis in which of the
following ways?

Answers

Answer:

A

Explanation:

the first one is the answer

Needed substances are carried to the body cells by:
A)enzymes
B)blood
C)water
D)food

Answers

blood The way needed substances are carried to the body cells.

valves Structure that prevents blood from flowing backward.

capillaries Vessels where materials are exchanged between the blood and the body cells.

ventricle Pumps blood out of the heart

Describe how people get energy from oil nonrenewable

Answers

Answer:

Oil can be burned to heat water, using the steam to generate power. Or, oil can be burned under pressure to produce exhaust gasses.

Which of the following terms describe the Fungi?
-symbionts
-parasites
-predators
-saprobes

Answers

Answer:

saprophytes

Explanation:

saprophtes not saprobes describe the fungi because they feed on dead organisms.

I hope this helps you

:-)

What is the main function of the endocrine system?

A. secrete hormones

B. send nerve impulses

C. produce blood cells

D. produce DNA

Answers

the main function is A, secrete hormones

Answer:

I think the answer to your question is option A , secrete hormones

Penecillin is a bacterium.
True
False

Answers

Answer: False

Explanation:

Answer:

False

Explanation:

They are antibiotics to fight off bacterial infections.

A city installs recycling centers that take wood products. How might the
recycling centers help increase the availability of wood?
O A. Recycling increases the cost of wood.
O B. Recycling increases the consumption of wood.
C. Recycling increases the supply of wood.
D. Recycling increases the demand for wood.

Answers

Answer:

C. Recycling increases the supply of wood

What are the products (comes out) of cellular respiration? (select all that apply)
A. Carbon dioxide

B. oxygen

C. Water

D. Glucose (sugar)

Answers

ANSWERS
A. carbon dioxide
B. glucose (sugar)
Yo WaSsuPp!!   ^v0!!

                         What are the products (comes out) of cellular respiration? (select all that apply)

A. Carbon dioxide

B. oxygen

C. Water

D. Glucose (sugar)

 Well Well Hello again XD, trust me when i say i'm not stalking you UvU...i'm just really into biology XD

Anyway the answer to your question is:

               Carbon dioxide and Water!!I apologize if i'm wrong//You're welcome if i'm correct

((-Side Note-)): glad i could help lol

                            I hope you have a great day ^v^"

what are the different ways to recycle biodegradable waste?​

Answers

Answer: Composition maybe?

Explanation:

imagine a population of squirrels in which the squirrels are a range of sizes.
how can this type of diversity affect the population?

Answers

Increases the genetic variation within the population.

What is the purpose of the heart in the circulatory system?
Select one:

It provides oxygen during the release of hormones.

It is the muscle the pumps blood around the body.

It prevents pathogens from invading the organism.

It controls all of the body's functions.

Answers

Answer:

It is the muscle that pumps blood around the body

Explanation:

Nick has had a very stressful job for more than 10 years. At Nick’s annual doctor’s visit, what effects would the doctor most likely identify in Nick?

Answers

Answer:

don't known ask the goggle

What invertebrates only live in salt water?

sponges

echinoderms

mollusks

cnidaria

Answers

Answer:

echinoderms

Explanation:

echinoderms are a group of aquatic invertebrates but they are only found in salt water

Answer:

Sponges

Explanation:

They can only live in salt water

The number of small tree finches is increasing on an island inhabited by a large population of small ground finches. State one reason why the population of small ground finches has not been affected by the increasing number of small tree finches.

Answers

Answer:

yes

Explanation:

IS THIS CORRECT?? IF NOT WHATS THE ANSWER PLEASE

Answers

Yup it is correct

Hope u get good marks stay safe
:D

what do you mean by faunal Diversity

Answers

Answer:

animal life especially

Explanation:

i hope it helps

this is my answer

correct me if im wrong

#carryonlearning

What nervous system is controlled by the hypothalamus?

Answers

Answer:

The hypothalamus is the key brain site for central control of the autonomic nervous system, and the paraventricular nucleus is the key hypothalamic site for this control.

Explanation:

Four friends were talking about the food they ate. Here is what they were discussing. • Kaustubh: ' It gives us energy to walk, run and lift things." • Shailaja: "It becomes a part of our body." • Jayasree: "It helps to fight diseases." • Aarti: "It is needed for the functioning of organs like the heart, brain and lungs." Who is correct?

Answers

I think Kaustubh is correct “it gives us energy to walk, run, and lift things.”

what is sustainable development?
what is environmental conservation?

Give short answer​

Answers

Answer:

The long term development which is done by the preservation ,utilization and management of resources which is used by present generation and with preservation for future generation is sustainable development.

the conservation of habitat of living beings and plants is called environment conservation.

helppppppp plzzzzzzzzzzzzzzzzz

Answers

Answer:

A

Explanation:

Im not sure what this is but im pretty sure its A it just seems the most logical but once u get someone good to answer this tell me if u got it right or not im curious bhaaajjajaja

In what part of the plant are substances transported to where they are needed?
A. Roots

B. Stem

C. Leaves

Answers

Answer:

B. Stem.

hope it helps

stay safe healthy and happy.

Answer:

B. Stem

Explanation:

In the stem part of the plant are substances transported to where they are needed. So, the option (B) is the correct answer.

Explica qué son los codones y los anticodones La siguiente secuencia de nucleótidos de ADN codifica para una secuencia de aminoácidos que forman una proteína hipotética, encuentre la secuencia de codones, anticodones y aminoácidos que se forman 5 ` A T G A G C A C C C A A A C T T G C TC T T A T T C T A A A A A G A C T 3

Answers

Answer and Explanation:

La informacion genetica de ensamblaje de aminoácidos durante la sitntesis proteica, se almacena en unidades llamadas codones.

Un codón es una secuencia corta de tres nucleotidos provenientes de la cadena de ADN o ARN mensajero. Cada codón representa uno de los 20 aminoácidos disponibles para sintetizar la proteina. En total hay 64 codones, de los cuales 61 codifican aminoácidos (mas de un codón puede codificar para el mismo aminoácido), de los cuales uno de ellos a parte es el codon de inicio de sintesis proteica. Los restantes tres codones corresponden a codones de finalización.

El anticodón es la secuencia de nucleótidos presentes en ARN de transferencia, que complementa a cada codón de ARN mensajero. De esta forma el ARNt reconoce el aminoácido correspondiente y lo ensambla en la nueva proteina.

ADN ⇒ 5 ` ATGAGCACCCAAACTTGCTCTTATTCTAAAAAGACT 3

Codones   ATG-AGC-ACC-CAA-ACT-TGC-TCT-TAT-TCT-AAA-AAG-ACT

ARNm ⇒  UACUCGUGGGUUUGAACGAGAAUAAGAUUUUUCUGA

Codones  UAC-UCG-UGG-GUU-UGA-ACG-AGA-AUA-AGA-UUU-UUC-UGA

Recordá que para ARNm, la secuencia de nucléotidos debe ser la complementaria para ADN.

Anticodones de ARNt ⇒ Complementarios a los codones de ARNm. Recordá que para los ARN, la timina se reemplaza por uracilo.

AUG-AGC-ACC-CAA-ACU-UGC-UCU-UAU-UCU-AAA-AAG-ACU

La proteina se construye en función de la información del ARNm, es decir que para la selección de aminoácidos, se consideran los codones del ARNm, y no los anticodones de ARNt.

UAC-UCG-UGG-GUU-UGA-ACG-AGA-AUA-AGA-UUU-UUC-UGA

TYR  SER  TRP  VAL   Stop  THR  ARG  ILE  ARG  PHE  PHE  Stop

Compare how the human body breathes in and out. Describe what happens to the ribcage, the diaphragm and chest volume. use key scientific words. Well detailed please.
I’ll give brainliest

Answers

Ok so I just gave this answer to someone here u go too

12. Flowers whose reproductive structures consist only
of stamens would be able to produce
A) fruits with seeds
B) fruits without seeds
C) pollen
D) ovules

Answers

Answer:

Pollen reproductive structures consist only

of stamens would be able to produce

Explanation:

No C is the answer

Reproductive structures are structures that make up the reproductive organs of a particular organism. These structures could include either female or the male reproductive organs.

Flowers with reproductive structures that comprise of only stamen would produce only pollen (option c).

Stamens are reproductive organs found in plants and they are male reproductive organs. For fruits with seeds to be formed the male and female reproductive organs must come together to produce a fruit.

Flowers with only the stamen will produce only pollen which is a male gamete that needs to be joined to the female gamete, ovary produced from the female reproductive structure (pistil) in a plant to produce a fruit.

Learn more: https://brainly.com/question/23140508

What controls traits and inheritance?
gametes
nucleic acids
proteins
temperature

Answers

Answer:

B.

Explanation:

the answer is nucleic acid

Answer: B

Explanation:

What is the current to the following DNA strand TATTAGATTACA

Answers

Answer:

ATAATCTAATGA

Explanation:

Nucleic acid sequence of bases that can form a double- stranded structure by matching base pairs. DNA has four nucleobases: adenine, thymine, guanine, and cytosine. The nucleobases in a DNA strand have preferred partners to form hydrogen bonds with. Cytosine pairs with guanine, and adenine pairs with thymine. These are the base pairing rules that allow DNA replication and protein synthesis to happen.

When considering ecosystem biodiversity, why would it be dangerous to treat each ecosystem as an isolated environment?
1. each ecosystem has a constant and consistent number of predators
2. rainfall is global occurrence that impacts every ecosystem on the planet
3. environmental conditions appearing in one ecosystem may appear in another
4. there are complex interactions that take place between ecosystems

Answers

Answer:

1

Explanation:

they can never be mixed

Other Questions
Which of the following is NOT a main duty of the Speaker of the House? Ocuocktxjrxutxjxttuxudutx PLZ HELPVelda Brigadoon Alguien que me haga algo parecido a eso, es un acrstico de un cuento, que te inventes help.......................... In the event that sexual intercourse occurs without contraception, how mightpregnancy be prevented?A. By obtaining birth control pillsB. By douchingC. By hormonal methodsD. By using the "morning after pill Using newly acquired grade-level words in reading, writing, and speaking facilitates confidence in these skills. True or false The shirts I want to order come instyles_____and colors.hazardousassortedurgentdecaying Ad space can be purchased by companies to place advertisements in the form of pop-ups and banners on another companys websites. Please select the best answer from the choices provided T F what is the measure of angle D? A.) 75B.) 80C.) 95 D.) 110 which statement regarding these methods of reproduction is correct? can anyone help me with this question The Chinese philosopher Confucius wrote his ideas on social virtues in? 8. It is the measure of the space inside the solid figure.b. surface areaC. circumferenced. volumea. area 1. What economic concerns caused the Civil War?2. Why were the Native Americans resistant to establishing a relationship with the U.S. government after the Civil War? 2 |m - n| + k (if k = -2, m = -7, and n = 4)(Those aren't 1s, they're the absolute value thingies) Need help!!!!!!!!!!!!!!!! Help meeee pleasssseeee For a specific volume of 0.2 m3/kg, find the quality of steam if the absolute pressure is (a) 40 kPa and (b) 630 kPa. What is the temperature of each case? Highlight the answers26 Irelands great export in the 1840s was a people. b potatoes. C whiskey. d wool.27 Eli Whitney was instrumental in the development of the a steamboat. b steel plow. c mechanical reapers. d cotton gin.28 The basis for modern mass-production was the a musket. b cotton gin. c principle of limited liability. d use of interchangeable parts.29 New transportations systems such as turnpikes, canals, and steamboats a lowered freight rates. b encouraged economic growth. c facilitated migration of peoples. d all of the above.30 Deists endorsed the religious concept of a a supreme being who created the universe. b revelation. c original sin. d none of the above.31 Northern attitudes toward free blacks can best be described as a supporting their right to full citizenship. b advocating black migration to new territories. c very racist. d none of the above.32 Slaves were a regarded primarily as financial assets by their owners. b the primary form of wealth in the South. c profitable for their owners. d all of the above.33 The view that God ordained the growth of the U.S. across North America a was referred to as Manifest Destiny. b Isolationism. c Continentalism. d none of the above.34 The Mexican American War resulted in a one-third increase in the territorial sine of the United States. b combat experience for the future Civil-War military leaders. c increased respect for American military and naval capabilities. d all of the above.35 The man who opened Japan to the United States and the West was a Clayton Bulwer. b Matthew Perry. c Franklin Perce. d John C. Calhoun.36 The major result of the famous Lincoln-Douglass Debates was that they a gained Douglass the Illinois senate seat. b gained Lincoln the Illinois senate seat. c propelled Lincoln into the national spotlight. d destroyed Lincolns political career.37 In his raid on Harpers Ferry, John Brown intended to a discredit abolitionists. b make Kansas a free state. c foment a massive slave rebellion. d force a political compromise on the slavery issue.38 The impeachment of President Andrew Johnson. a resulted in his conviction and removal from office b resulted in a not guilty vote by a massive majority favoring Johnson. c was led by Radical Republicans who saw him interfering with with Reconstruction. d was the only time a president has been impeached39 The Emancipation Proclamation declared free only those slaves in a the Border States b Slave States that had remained loyal to the Union. c United States territories. d states in rebellion against the United States.40 Radical Republicans policies came to dominate Reconstruction because a they had the majority of votes in the Senate. b of Lincolns assassination. c of the views of the conquering Union generals. d collusion with northern industrialists.Extra Credit (2 points each, 20 for all)List the three (3) important political firsts of the election of 1832:123List five examples of modern warfare associated with the American Civil War:12345