If m and n are rational numbers such that root m + root n = root 7+ 48, calculate the possible
value of m^2+n^2?.

Answers

Answer 1

Answer:

2353

Step-by-step explanation:

7^2+48^=2353


Related Questions

What is the common ratio for the sequence 5.-10. 20.-40. ?
-2
-1/2
1/2
2​

Answers

Answer:

-1/5

Step-by-step explanation:

i think thsts correct answer if not the answer is 1/2

simplify 4 by 5 + 2 in bracket 3 minus 2 by 3 in bracket​

Answers

Answer and Step-by-step explanation:

(4 × 5 + 2)(3 - (2 × 3))

I think this is it but I'm not sure.

22 × -3 = -66 is I think the answer.

#teamtrees #PAW (Plant And Water)

Answer:

98/15

Step-by-step explanation:

[tex](\frac{4}{5} +2)[/tex][tex](3-\frac{2}{3} )[/tex]

=(4 + 5*2)/5  (3*3 -2)/3

=(4+10)/5  (9-2)/3

=(14/5 )(7/3)

if there is no any sign between the two fraction inside bracket then it means to multipli.

=14/5 * 7/3

=14*7/5*3

=98/15

I don’t understand this equation. m= -3 and b = 3

Answers

can you please put the equation so i can answer it?

thank you!

Can you please put the equation so that we could answer it

whats the value of x?

Answers

Answer:

6.92820323=x

Step-by-step explanation:

Since this is a right triangle, we can use trig functions

sin theta = opp / hyp

sin 60 = x /8

8 sin 60 = x

6.92820323=x

And the last answer is aslyn did not substitute the correct value for the height in the formula


100 points

Answers

Step-by-step explanation:

I think the answer will be step 3

Abigail buys two cartons of strawberries. One carton has 19 berries and the other carton has 26 berries. She wants to divide the berries into bags so there are exactly 6 berries in each bag. How many bags will have 6 berries?

Answers

Answer:

7.5 bag

Step-by-step explanation:

Carton #1: 19 berries

Carton #2: 26 berries

^^add them up together to get hte total amount of berries! 19 + 26 = 45

She has 45 berries in total, then you divid it by 6 aka the amount of berries she wants in each bag 45 ÷ 6 = 7.5

When she divids them up she has 7 bags with 6 berries in each and 1 bag with 3 berries.

help please asap ASAP ASAP ASAP PLEADEEEEEEEEE​

Answers

SOLUTION OF TRIANGLE:

a i) use this formula, a² = b² + c² - 2bc cos A

a² = 8² + 10² - 2(8)(10) cos 60
= 84
a = 9.17 cm

UW = 9.17 cm

ii) use formula no 12 as attached :

sin
to solve this,

( sin 40 / 11 ) x 9.17 = 0.5358511

press shift sin on ur calc & the answer is :


FUNCTION

a) f(x) = x-3
g(x) = x²-1

i) f(6) = 6-3

substitute x with the value given in the bracket into equation

f(6) = 6-3
= 3

ii) to do inverse function use this formula :

u = f(x)
u = x - 3

and then make x as the subject

x = u + 3

after that, just change u to x

f-1(x) = x + 3

iii) f [ g(2) ] = f [ g(-2) ] = 0

g(2) = (2)² - 1 g(-2) = (-2)² - 1

= 4 - 1 = 4 - 1
= 3 = 3

f(3) = 3-3
= 0





Please someone help me

Answers

Answer:

A

Step-by-step explanation:

Because not drawing the circle graph of the burger could lead you to draw the wrong conclusion

Answer:

A

Step-by-step explanation:

If your not drawing the circle graph of the burger could lead you to draw the wrong conclusion

write and solve an equation given the following information. Angles 1 and 2 are complementary. the measure of angle 2 is 18 larger than the measure of angle 1.
A.) x + (x + 18) = 90, x = 36
B.) x + (x + 18) = 180, x = 81
C.) 2x + 72 = 90, x = 9
D.) x + (x - 18) = 90, x = 54


Will give brainlist!!

Answers

The answer is A because complementary is 2 angle that add up to 90

check whether 7+3x is a factor of 3x^3+7x

Answers

Answer:

no

Step-by-step explanation:

refer to picture for solution

En la figura se muestran dos bloques de m1= 0,8 Kg y m2= 0,2 kg si el bloque de masa m2 es arrastrado por el bloque masa m1 calcular la aceleracion del sistema y la aceleracion de la cuerda

Answers

Answer:

The acceleration in the system and in the rope is same as 5.88 m/s2.

Step-by-step explanation:

The figure shows two blocks of m1 = 0.8 Kg and m2 = 0.2 kg if the block of mass m2 is dragged by the block of mass m1 calculate the acceleration of the system and the acceleration of the rope

Let the acceleration is a and the tension in the string is T.

Use Newton's second law

[tex]m_1 g - T = m_1 a ..... (1)\\\\T -m_2 g = m_2 a ......(2)\\\\Add both of them \\\\(m_1 - m_2) g = (m_1 + m_2) a \\\\(0.8-0.2)\times9.8 = (0.8+0.2)a\\\\a = 5.88 m/s^2[/tex]

Thank you to whoever helps :)

Answers

(-5, -1)

Hope this helps! :)

Work out the size of angle X

Answers

Answer:

x = 105

Step-by-step explanation:

The angles are corresponding angles and corresponding angles are equal if the lines are parallel

x = 105

Answer:

105°

Step-by-step explanation:

The angles are corresponding therefore they are equal

half of a dome is called what?​

Answers

Answer:

See I don't know the Answer but I Need points to ask question so Sorry

Step-by-step explanation:

Find the missing side. Round to the nearest tenth.
A.7.1
B.5.1
C.5.1
D.6.1​

Answers

Answer:

5,1

Step-by-step explanation:

x= tan27⁰ x 10 ≈ 5,1

.....

Answer:

b or c or 5.1

Step-by-step explanation:

The basic trig identity that does not involve the hypotenuse is the Tan(theta).

Tan(theta) = opposite / adjacent. That definition applies only to a right triangle. It has to be modified if the triangle is some other kind.

The opposite side is the one not making up the reference angle (x in this case).

The adjacent side is the one making up the angle that is not the hypotenuse.

opposite side = x

adjacent side = 10

theta = 27 degrees.

Tan(theta) = opposite / adjacent

Tan(27) = x / 10

Tan(27) = 0.5095

0.5095 = x / 10               Multiply by 10

10*0.5095 = x

x = 5.095

It rounds to 5.1

No one except the answer key can know whether to choose b or c.

Find the area of the shape 11cm 14cm 9cm 20cm who ever answers correctly gets brainlist

Answers

Answer:

Step-by-step explanation:

Given :    shape 14cm 11cm 9cm 20cm

To Find : Find area

Solution:

20 - 1 1 = 9 cm

We can divide figure in 2 parts

rectangle = 14 cmx 11 cm

square = 9 cm x 9  cm

Area of rectangle = 14 * 11 = 154 cm²

Area of square = 9 * 9 = 81 cm²

Total area = 154 + 81

= 235 cm²

Learn More :

Find the area of the given figure withTU = 6 cm, SR = 8 cm, UR = 15 ...

brainly.in/question/14804329

In the figure, triangle ABC in the semi circle . Find the area if the ...

brainly.in/question/13845921

Answer:

Area = 235 square cm

Step-by-step explanation:

Given :    shape 14cm 11cm 9cm 20cm

To Find : Find area

Split the figure into rectangle and square:

Rectangle : 14 x 11

Square : 9 x 9

[tex]Area \ of \ rectangle : 14 \times 11 = 154 \ cm^2[/tex]

[tex]Area \ of \ square = 9 \times 9 = 81 \ cm^2[/tex]

[tex]Total \ area = 154 + 81 = 235 \ cm^2[/tex]

 

Which statements about the graph are true? Check all that apply.

Answers

Answer:

is there a picture you can show me?

Step-by-step explanation:

yes need help again im on my math exam review thing i.dk wut it tis also here are some extra points im feelin nice today btw dont jus answer for the points or put a site or ill report.


ᴍɪʟʟʏ~

Answers

Answer:

(-5) + 8 + (-5) = -2

Step-by-step explanation:

The first point is 5 points to the left of 0, or -5

Next, it goes right 8 units (+8) and lands on 3

THen it goes back 5 units (-5) and lands on -2

If my answer is incorrect, pls correct me!

If you like my answer and explanation, mark me as brainliest!

-Chetan K

A gym charges a one-time fee of $60 to join and membership dues of $25 per month
Part A
Complete the table to show how the total cost in dollars, C, and the number of months, m, of gym membership are related. Drag numbers to
complete the table. Numbers may be used once or not at all.
865
200
410
205
135
75
505
260
ות
3
8
14
C
Part B.
Which equation represents the total cost based on the number of months of gym membership?
O А.
C = 25m
B В.
C = 60 + 25m
Review progress
Question 5
of 22
Back
Next →

Answers

Answer:

Step-by-step explanation:

C=25m plus 75

A regulation-size women's basketball has a diameter of 9.07 inches. What is the surface area of the basketball? Use 3.14 for π and round to the nearest tenth.

Answers

Answer:

258.3 sq inches

Step-by-step explanation:

Use the sphere surface area formula, SA = 4[tex]\pi[/tex]

The diameter is 9.07 inches, so the radius is 4.535 inches.

Plug in 3.14 as pi and 4.535 as r, and solve:

SA = 4[tex]\pi[/tex]r²

SA = 4(3.14)(4.535)²

SA = 258.3

So, the surface area is approximately 258.3 sq inches

What is the solution to the inequality x2 + 5x ≥ 6?

Answers

Answer:

x ≤ −6 or x ≥ 1

{x+y=-4
{y=2x-1

Help please. Thanks in advance.

Answers

X+y=-4
2x-y=1
—————
3x=-3

X=-1

Now replace x in one of the equations to find y

Y=2(-1)-1= -3

Final answer =

X= -1

Y= -3

You bought your car at the cost of $3000.If the value depreciates each year at a rate of 5%.By how much did the value of the bicycle devalued

Answers

Answer:

$150

Step-by-step explanation:

Given

Price of car = $3000

Percent depreciation = 5%

Depreciation amount = 5% of $3000

Depreciation amount = 0.05 * 3000

Depreciation amount = $150

New value for the car = 3000 - 150

New value for the car = $2850

The value of the car devalued by $150

Which of the binomials below is a factor of this expression?
4x² - 25y2z2
O A. 4x - 5yz
B. 4x2 - 5y2 22
O c. 2x2-5y2 2
O D. 2x - 5yz

Answers

Answer:

the answer is D

1.step by step explanation :

[tex]4 {x}^{2 } - 25 {y}^{2}{z}^{2} [/tex]

[tex] \sqrt{4 {x}^{2} } - \sqrt{25 {y}^{2} } {z}^{2} [/tex]

2x-5yz

Which function describes this graph?

Answers

The answer is C. Y= x^2+7x+10

Verify Expreimentally that if all sides and all angles of a quadrilateral are equal then it is the square​

Answers

Answer:

Wikipedia says:

"In geometry, a square is a regular quadrilateral, which means that it has four equal sides and four equal angles (90-degree angles)."

https://en.wikipedia.org/wiki/Square

Step-by-step explanation:

18.
Which of the following are the coordinates of the vertex of y= x2 - 10x + 2?

A. (–5, 23)

B. (–10, 2)

C. (5, –23)

D. (2, –10)

Answers

B ( -10 , 2 ) hope this helps you!!

Hi there!  

»»————- ★ ————-««

I believe your answer is:  

C. (5, –23)

»»————- ★ ————-««  

Here’s why:  

I have graphed the given equation on a program. The vertex can be described as the 'turning point' of the parabola. When graphed, the parabola shows a vertex at (5, -23).See the graph below.

»»————- ★ ————-««  

Hope this helps you. I apologize if it’s incorrect.  

A woman buys 50 eggs for $6.60. Some cost 12 cents each and the rest 14 cents each.
How many of each kind of eggs has she bought?​

Answers

Answer:

She bought 20 eggs that were 12 cents, and she bought 30 eggs that were 14 cents.

Step-by-step explanation:

Create a system of equations where x is the number of 12 cent eggs and y is the number of 14 cent eggs.

x + y = 50

0.12x + 0.14y = 6.6

Solve by elimination by multiplying the top equation by -0.12:

-0.12x - 0.12y = -6

0.12x + 0.14y = 6.6

Add these together and solve for y:

0.02y = 0.6

y = 30

So, she bought 30 eggs that were 14 cents. Plug in 30 as y into one of the equations, and solve for x:

x + y = 50

x + 30 = 50

x = 20

So, she bought 20 eggs that were 12 cents.

She bought 20 eggs that were 12 cents, and she bought 30 eggs that were 14 cents.

Determine f’s end behavior

f(x)= -5x^6+8x^5-1/ x^2 -9

Answers

Answer:

f(x) → -∞ as x → -∞

f(x) → -∞ as x → +∞

Step-by-step explanation:

The given function is;

f(x) = -5x^(6) + 8x^(5) - 1/(x² - 9x)

Using long division to divide this as attached, we have;

f(x) = -5x⁴ - 37x³ - 333x² - 2997x - 26973 + (-242757x - 1)/(x² - 9x)

Thus, the leading coefficient here is -5 and the polynomial degree is 4.

Since the leading coefficient is negative and the degree of the polynomial is an even number, then we can say that the behavior of the polynomial is;

f(x) → -∞ as x → -∞

f(x) → -∞ as x → +∞

pls answer. im not smart

Answers

Step-by-step explanation:

A.

20-4-681041214-2

B.

68-20-4212881412
Other Questions
What is the definition of 'gist'?The facts used by the author to make a point.The main point or essence.The transitions between paragraphs.The conclusion of an article A rental car company charges $80 per day to rent a car and $0.10 for every mile driven. Alyssa wants to rent a car, knowing that: She plans to drive 150 miles. She has at most $300 to spend. Which inequality can be used to determine xx, the maximum number of days Alyssa can afford to rent for while staying within her budget?Geq30080x+15300 15x+80\leq30015x+80300 80x+15\leq30080x+15300 15x+80\geq30015x+80300 Consider Hermia's first words when she enters the scene. How do her comments about the setting relate to the action of the scene? In particular, how might Shakespeare intend a double meaning here for her use of the word "sense"? A woman sold an article for 20.00cedis and made a profit of 25%.Find the cost price of the article. What is the sign of -9. (0/-3) If a firm's marginal tax rate is increased, this would, other things held constant, lower the cost of debt used to calculate its WACC. True False When evaluated, which expression has a result that is a rational number? How does convection cause ocean currents?A. During the process of convection, energy is transferred to the atmosphere forming winds. These winds power surface currents.B. During the process of convection, the heating of surface water by the sun results in upwelling.C. During the process of convection, energy in warm water is lost to its surroundings. The water cools, becomes denser, and sinks.D. During the process of convection, more minerals and gases dissolve in warm water. This increases the density of the warm water and causes it to sink. The angle of elevation to a nearby tree from a point on the ground is measured to be31. How tall is the tree if the point on the ground is 62 feet from the tree? Roundyour answer to the nearest tenth of a foot if necessary. Lighting is the movement of? A business manager finds that the building expense each month is completely uncorrelated with revenue levels. What should the business manager assume about this cost? What is 100 5 4 + 43 A. 69B. 144C. 0.3D. 1.2 HELP 18 POINTSJournal prompt to be answered in 2 fully developed paragraphsPrompt: How does physical activity prevent disease and reduce health care costs? Use specific examples from your experience. how can an irreverible step in a metabolic pathway be reversed?A. When both the reactants and products have equal amounts of energyB. When the reactants contain large amounts of energyC. When another chemical reaction with a large amount of energy occurs at same time D. when collision of substances generate the energy neededhow can an irreverible step in a metabolic pathway be reversed?A. When both the reactants and products have equal amounts of energyB. When the reactants contain large amounts of energyC. When another chemical reaction with a large amount of energy occurs at same time D. when collision of substances generate the energy neededOrder the sequence of events in transcription?1- free ribonuleotide triphosphates base-pair with the deoxyribonucleotides in the DNA template 2- RNA polymerase binds to the promoter region of a gene3- primary rna transcript is formed 4- two DNA strands are seperatedWhich organic molecule is not found on the plasma membrane?A. carbohydratesB. cholestrolc. phospholipidsd. proteinsWhat does this statement mean : "Information flow between cells tissues and organs is an essential feature of homeostasis and allows for integration of physiological processes"A. the nervous system is the most prominent body system for integration of physilogical processes B. some substances can affect local processes while others travel to exert their effects on other distant parts of the bodyC. communication between body structures through body fluids is the most important physiological processesD. Neurotransmitters, hormones, paracrine and autocrine substances exert their efferts locally as well as distant body structureswhich statement best describes the orientation the phospholipid molecules in a membrane:A.) the nonpolar fatty acids are oriented towards the cholestrol moleculesB.) the hydrophilic layer is oriented towards the middle of the phosphlipids C.) phospholipids align themselves in the membrane in a bimolecular layerD.) the hydrophobic and hydrophilic structures point away from the cellWhich is NOT a product of glycolysis under aerobic and anaerobic conditions?A.) lactate B.) FADH C.) pyruvate D.) NADH Which reason is why water is an essential nutrient? A.) water needs to move between compartmentsB.)can be obtained through ingestionC.) body cant make enough water for its needsD.) water evaporates from the skin that has the largest surface area among all body structures loa (speaker) thuc nhm thit b no ? From the top of the leaning tower of Pisa, a steel ball is thrown vertically downwards with a speed of 3.00 m/s. if the height of the tower is 200 m, how long will it take for the ball to hit the ground? Ignore air resistance. Suppose that the speeds of cars travelling on California freeways are normally distributed with a mean of miles/hour. The highway patrol's policy is to issue tickets for cars with speeds exceeding miles/hour. The records show that exactly of the speeds exceed this limit. Find the standard deviation of the speeds of cars travelling on California freeways. Carry your intermediate computations to at least four decimal places. Round your answer to at least one decimal place. Which guarantees do the Sixth and Eighth Amendments to the Constitution make?the right of all citizens to keep and bear arms and freedom from illegal searches and seizures conducted without search warrantsthe right of arrested persons to remain silent when in custody and the freedom to peacefully assemble and protest the actions of the governmentthe right to be brought before a judge to decide whether ones imprisonment is legal and the freedom to file lawsuits based on federal, state, and local statutesthe right of accused persons to be defended by a lawyer in a speedy public trial and freedom from cruel and unusual punishments and excessive bail Express this sense sequence as a polypeptide. Use the three letter abbreviation and separate the amino acids with a dash - e.g. Trp-Thr-Ala. If there is a stop codon - you may add an asterisk to the sequence - e.g. Trp-Thr-Ala-* ATTTTAGCCATGCCCGGGAAAATACGCCGCCCTCCCGGTACACCATTGTTCGGCAAATAAAAATAAAAT polypeptide sequence [answer1] what is the DNA sequence of the 5' UTR? [answer2] what is the RNA sequence of the 3' UTR [answer3] Tia and Sam are partners who solely own T and S Florist. As owners, they can:______.a. claim the organization as their legal property. b. can't sell the company. c. claim only limited liability. d. avoid taking any legal responsibility for T and S. e. decide not to pay a dividend to their stockholders.