If the fans don't buy all the candy bars, pack them
away until the next game.

Choose the replacement for the word them which BEST removes the vagueness in this sentence.

A)it
B)those
C)all them
D)the candy

Answers

Answer 1

Answer:

b

Explanation:

because they are past


Related Questions

Describe how Jing-mei's character traits change or stay the same throughout the story. What are her motivations? What conflicts lead to her character traits?
no obvious answers like idk

Answers

Answer:

Jing-mei starts out being excited and confident about her mother's plans for her. She believes that if she and her mother found the right kind of prodigy for Jing-mei, then Jing-mei would one day become a perfect child. As she begins losing hope, however, Jing-mei's character starts to change. Tired of constantly failing her mother's high expectations, she decides to set her own expectations, and she becomes willful, disobedient, and vocal. Ironically, her motivation throughout the story stays the same; she wants her mother to love and accept her. She knows she'll never be the type of girl her mother wants, so she resists her mother's wishes. Yet by doing the opposite of what her mother wants, Jing-mei still cannot feel that acceptance that she really wants.

Answer:

the answer above works i got it right :))

Explanation:

Who was Fezziwig?
A.Scrooge's mean father
B.Scrooge's master (boss) when he was a happy boy.
C.Scrooge's rich uncle.
D.Scrooge's older and wiser brother.

Answers

Answer:

B. ?

Fezziwig was scrooge's master im pretty sure.

Answer:

b

Explanation:

Scrooge apprenticed under Mr. Fezziwig.

ESSAY: SUMMARIZING A FORMAL ESSAY One of the keys to understanding a formal essay is picking out its main idea. Writing a summary is a good way to practice this skill. For this project, you'll summarize a formal essay. OBJECTIVES Summarize a formal essay. Instructions: Choose a formal essay and summarize it in the box below. Remember these points of a good summary: The topic sentence includes the main idea. The summary is clear and concise. The summary is about one-fourth to one third the length of the original. It expresses the author's ideas, not a private interpretation. Be sure to name the essay, its author if available, and where you found it (book title and author/editor, magazine title and date, etc)

Answers

Answer and Explanation:

The essay entitled "The plastic problem" was published in a magazine on ecology and environment on February 27, 2019, by an unnamed author.

The essay addresses how plastic is a very important material for the development of human activities, being a very useful material and of great versatility in our society. However, plastic has been improperly disposed of and its nature is not biodegradable, which means that plastic, when thrown in natural environments, promotes pollution that extends for years on end, causing serious problems to fauna and flora Of region. Thus, the author reinforces the idea that plastic must evolve together with the evolution of society and the need that the planet presents. The author shows how the planet needs to be preserved, as well as all the natural resources it has. In this way, it is necessary to take action on the plastic.

According to the text, how did the Scottish and Irish peoples beliefs influence how Americans celebrate the fall season? Write 3-4 sentences and support you answer with specific examples from the text

Answers

Americans celebrate the fall season in many ways. One way people do this is through Halloween. This is true because according to the text "Everywhere you walk..you might wonder why pumpkins are appearing on you neighbors porches."

Explanation:

Which inventions have helped shape the way advertising works today? (Select all correct answers)
modern psychology
the Internet
the airplane
the printing press

Answers

Answer:

The answers are all except c. So, a b and d are the correct answers.

Explanation:

Though air travel did much to revolutionize postal and travel industries, it did not contribute much to the art of advertising.

Modern psychology, the Internet, and the printing press have helped shape the way advertising works today. Thus, options A, B, and D are correct.

What is an advertisement?

"Advertisement can be defined as an announcement or information that is being given to the public regarding a particular product brand or event. It is let the people know that this brand or thing exists. And the main motivation for them to buy the product or service."

The inventions have helped the advertising industry a lot as they can change the psychology or implement the product according to the psychology of people.

Also the Internet and printing press help them to reach various people and let them know about their product. Therefore, option A, B, and D is the correct option.

Learn more about advertisement, here:

https://brainly.com/question/15097462

#SPJ2

First, gather all of your print sources, such as books, magazines, and encyclopedias. Decide which ones you are most likely to use. Then, create a source card for each one by writing the title, author, page number, and any other important information on an index card. When you are finished, number each of your source cards. This way, as you begin to take notes, you can just write the number of the source instead of writing all of the information again and again. Based on the details in the passage, which inference is most likely true? A. The source cards will be collected and graded , along with the report. B. The author believes that citing a source properly is more important than saying something interesting about it. O C. Readers are not expected to quote sources directly, but instead to paraphrase information . O Keeping track of sources in an organized way is an important part of research.

Answers

Answer:D: Keeping track of sources in an organized way is an important part of research

Explanation:

I TOOK THE TEST ON A P E X

Answer:

d

Explanation:

ape x

Read the excerpt from "Elizabeth Blackwell." Over the next three weeks Elizabeth did think about the medical profession. In fact, she couldn't stop thinking about it, for Mary's words rang continually in her ears. Even her heart seemed to beat in the rhythm of "doctor . . . Doctor . . . Doctor." Finally, one night, as she tossed and turned in bed, she found she could bear it no longer. "I am applying to medical school," she declared. The author makes this part of the story exciting by using strong action words. developing a slow pace. using rhyming patterns. developing Elizabeth's character.

Answers

Answer:

The author makes this part of the story exciting by using strong action words.

Explanation:

The author made sure to convey Elizabeth's feelings to readers through action words in this passage. When he/she mentions the way Elizabeth's heart is beating and how she tosses and turns in bed, the author is showing us, through those actions, how exciting the idea of becoming a doctor is to Elizabeth. Readers can empathize with the way she feels - all of us have experienced excitement and anticipation to the point of tossing and turning in bed, or to having our hearts beat loudly and rapidly.

Answer:

using strong action words.

Explanation:

edge

For his whole life, Nick has never been able to _____ early. When he was in elementary school, his mother would set the alarm clock for 6:00 am, but it wouldn’t _____ him _____. When Nick was in high school, his alarm clock would _____, but he simply _____ it _____ and _____ to sleep.

Every morning his father would shout, “_____, Nick! You’re going to be late!” The shouting did not help, however. On a few days, Nick would _____ two hours late! Nick knew that his school would not _____ this situation much longer. His parents were frustrated, but they could not _____.

One day, Nick’s mom _____ a blog on the Internet where people were sharing their stories about oversleeping and different solutions they had _____ to solve their problems. After _____ a few of these stories and realizing there could be an underlying health issue, Nick’s mother _____ her mind that the best advice was to _____ a sleep specialist on the Internet.

After _____ several websites, Nick’s mom _____ about a specialist for her son’s condition. She _____ him _____ and left a message. The next day, the doctor _____ her _____ to _____ Nick’s situation. Now the family is _____ him to help solve Nick’s problem.

Answers

Answer:

have a great day^^

Explanation:

Help please :(I


Directions: Create a Venn Diagram that shows how refugee children and immigrant children are similar and different based on the article.

Answers

Answer:

refugee children:  involuntarily leave, unsafe, by them selves

immigrant children: semi-voluntarily leave, safe, with family

both: taken away from home country, scared and alone

Part A: which of the following best states one of the central ideas of the article

Answers

Answer:

I need to see the article

Poor eating habits are a serious issue in this country.

Answers

Answer:

fax

Explanation:

its very true

Which of the following inferences about George Washington is best supported by the first paragraph of the excerpt?

Answers

Answer:

7-Eleven I will get it on Monday

Explanation:

its been a few weeks and I've never seen anything

Only need help with the last 2 question and the element I choose is oxygen


Atomic Structure and Forces Activity
Introduction
The periodic table provides a wealth of knowledge about every known element. From the table, you can learn about an element’s physical and chemical properties, such as its available valence electrons or reactivity with other elements. Using terminology and information from the lesson, you will conduct an “interview” with an element and publish what you discover about its properties and bonding capabilities.
Procedures:
Choose an element from the periodic table to interview.
Conduct research on your element. Use the following as a guide for the kind of information you need to learn about your element to successfully complete the assignment.

Atomic number
Atomic mass
Symbol
Number of subatomic particles
Its position on the periodic table and its chemical properties based on that position
Typical compounds formed by your element
The history of your element's discovery
Five uses for your element or its common compounds
Where your element or its compounds can be found in the real world
At least one photo or drawing of your element

Arrange the information into a coherent interview that consists of an introduction followed by alternating questions (to the element) and answers (from the element).
Use a magazine layout or similar format to present the interview. You may choose to complete the layout of the project with art supplies or using a computer or online resource.
Be sure the work is your own and you include citations for each of the resources included.
Conclude with a summary paragraph that answers your reflection questions.
(Use the student sample as a guide on format only. It does not include the full content required for the activity.)
Reflection Questions
Summarize the physical and chemical properties of the element you selected.
In the lesson, many models were used to depict the atom. How did these models help you understand atomic structure?
How do protons, neutrons, and electrons differ in terms of their electrical charges and locations within the atom?
Describe the four fundamental forces. Which of these forces are involved in chemical bonding?

Answers

Answer:

Protons neutrons and electrons

Answer:

can you add something like that about neon

Explanation:

please i need a good grade

I need help please. This is not a small voice.

Why do you think it's important for the speaker to assert that their voice and feelings are
not small? Does the author hint at either being oppressed or denied in the text?

Answers

Answer:

Is that a poem or a question you answer with a paragraph?

Explanation:

I don't want my class to get an answer sooo i am not saying the answer ; )

Ayye its Drippqueen. i got the bars. We all know rappin is not really hard.

In class we had to write a rap and tell what the rhyme scheme is. I dont know what a rhyme scheme is. Can you define what a rhyme scheme is and tell me what the rhyme scheme of my rap is please?

Answers

Answer:

Swear to god not tryin to get free pts but i fr don't see nun

Explanation:

Answer:

okay a rhyme scheme is something like aabbcc

your rap is ababc, let me give u an example

apples are tasty

but im really lazy

i was talking to much

so she told me to start walking

that right there is aabb

Explanation:

I am giving 100 points and will give brainly
think about these ones.
if a deaf person goes to a hearing would it still be called a hearing?
if you clean your shower doesn't that mean you are your shower's shower?

Answers

Answer:

a

Explanation:

Answer:

A

Explanation:

What words from the passage tell the reader that it is written in first person?

Answers

Answer:

You just have to find words such as I, we, mine, us, our, or ourselves

Explanation:

6.
What is the function of concrete detail in the Narrative of the Life of
Frederick Douglass, an American Slave?

7. Do you think that objectivity is always preferable to subjectivity?

Answers

Answer:

7. Objectivity is not always preferable to subjectivity sometimes you need a little personal bias in a story.

Explanation:

Question 5 (1 point)
The class (respect, respects) the views of the professor.
respect

respects

Answers

Answer: B. respects

Explanation: The class respects the views of the professor. This is the correct sentence for fixing the grammar.

I hope you have a great day! ^-^

How do Gracie and Daisy feel when Molly tells them they are going home?

Answers

Answer:

Gracie and Daisy feel sad and disappointed that their friend is leaving them.

Explanation:

Rewrite each sentence and use a comma to separate a city name and a state name where necessary.

1) Does your aunt live in Houston Texas still?
2) If I could live anywhere in the United States, I would pick Honolulu Hawaii.
3) My friend Ava just moved to Boise Idaho.
4) My dad is traveling to New York New York for work this week.
5) Sarah's mom is originally from Cleveland Ohio.
6) I moved here from Las Vegas Nevada when I was six.
7) My cousins are traveling to Orlando Florida in May.
8) In June, my family will be visiting Atlanta Georgia.
9) My oldest brother and his family live in Charlotte North Carolina.
My new neighbors are from Austin Texas.

Answers

1. Does you aunt still live in Houston, Texas?
2. if I could live anywhere in the United States, I would pick Honolulu, Hawaii.
3. My friend Ava just moved to Boise, Idaho.
4. My dad is traveling to New york, New york for this week.
5. Sarah’s mom is originally from Cleveland, Ohio.
6. Las vegas, Nevada
7. Orlando, Florida
8. Atlanta, Georgia
9. Charlotte, North Carolina
10. Austin, Texas
mark me as brainliest if i helped :)

Somebody please help ASAP. THIS WAS DUE TWO DAYS AGO AND I HAVE TO TURN IT IN PLEASE HELPP

Answers

Answer:

I have no idea how to do that sorry

Explanation:

Athena is the Greek goddess of reason, arts, and literature. She is the goddess of the city of Athens, which is named for her.
How does the sidebar help readers better understand the passage?
A. The sidebar explains who Athena is and helps readers understand why the builders worked to make the Parthenon perfect for her.
B. The sidebar explains that Athena loved beauty and helps readers understand why she only accepted beautiful objects.
C. The sidebar explains that Athena is the goddess of Athens and helps readers understand that the Parthenon is located there.
D. The sidebar explains that art was important to Athena and helps readers appreciate art.

Answers

Answer:

I think it might be A. XD

Explanation:

Answer:  it is B

Explanation: EDGE 2023

How does Henry convince his audience that the decisive moment to fight is at hand? and explain if its emotional or logical

Answers

Answer:

Are you from k12?

Explanation:

Answer:I guess its emotional wait 4 others answer too oky

Explanation:

Look at the thesaurus entry for curtailing.

curtailing \ (ˌ)kər-ˈtāl-iŋ \ decreasing, diminishing

Based on the entry, what is the best definition of curtailing in this sentence?

Due to lack of funding, the art club will be curtailing its activities this semester.


A) cutting back

B) extending

C) funding

D) revising

Answers

Answer:

A

Explanation:

Cutting back -- getting rid of a few or more things --

Based on the entry, the best definition of curtailing in this sentence is:

Option A

Let's understand the use of some words.

Use of wordsWhen using words in a sentence, it is very important that it fits into the context of the sentence.

Words convey meanings in a sentence. It is very proper to use appropriate meanings in a sentence.

The use of curtailing here actually means reducing its activities as used in the sentence.

Learn more about words on https://brainly.com/question/25938417

COMPARE AND CONTRAST: In both speeches—“Speech to the Second Virginia Convention” and “Remarks at the UN General Assembly”—the speakers argue for a widespread change they hope to see in their society. However, both pieces come from different literary periods. Patrick Henry delivered his speech in colonial America, whereas Ellen Sirleaf Johnson delivered her speech on today’s world stage to the United Nations. Compare and contrast the authors’ use of language across literary periods to advocate for change. Use evidence from both speeches to support your response.

Answers

Explanation:

Interesting in “Speech to the Second Virginia Convention” by Patrick Henry we note his use of figurative language to buttress his point and to compel his listening audience. He said emphatically, "We are apt to shut our eyes against a painful truth, and listen to the song of that siren till she transforms us into beasts."

Meanwhile, Ellen Sirleaf Johnson uses similar figurative language used by Henry, depicting the inaction of the world's government as a form of keep silent. She said,

"the call for the reform of the United Nations...rings louder in its definite silence.. we urge the nations of the world...to bring this long silence to an end."

DIRECTIONS: Read the paragraphs below.
Then, answer the questions that follow.
Jogging is more than exercise. Jogging causes the body to produce a group of hormones called endorphins. These hormones may then release natural painkillers that can reduce suffering from arthritis, allergies, or other ailments. Jogging might actually trigger relief from pain and help ward off the common cold.
Jogging can build not only muscles but also confidence. A program of regular jogging enables a runner to complete run after run while becoming stronger and more self-assured. A bonus can be increased self-esteem through weight loss and better body image. Sustained running also requires self-discipline, which can benefit a runner’s ability to stay with a task to completion.

1. Which sentence in the first paragraph directly states the writer’s claim about jogging?

2. What is the main point, or reason, of the second paragraph?

3. List three specific details the writer presents as evidence.

Answers

Answer:

1) "Jogging is more than exercise"

2) The second paragraph is explaining the second reason to why jogging is more than exercise

3)

"Jogging causes the body to produce a group of hormones called endorphins" (shows how jogging can help with arthritis, etc.)

"A bonus can be increased self-esteem through weight loss and better body image" (shows how jogging can increase confidence)

"Sustained running also requires self-discipline, which can benefit a runner's ability to stay with a task to completion." (shows how jogging can increase confidence)

Explanation:

for number 1:

"Jogging is more than exercise" is the writer's claim because usually the first sentence of the paragraph explains what they think, and the rest is why they think what they think (evidence and explanation of evidence).

for number 2:

The paragraphs to explain the writer's reasoning behind their claim in general, so naturally the second paragraph is just that, the second reasoning behind why the writer thinks jogging is more than exercise.

for number 3:

Evidence and explanation of evidence is what makes up the middle of every body paragraph in essays, so it's just a matter of seeing which sentences are the evidence and which are the explanations of evidence. I'm not sure about the third evidence I put, but I think it's right.

This passage discusses the benefits of jogging beyond just exercise. The first paragraph explains how jogging can trigger relief from pain and reduce suffering from certain ailments. The second paragraph highlights how jogging can build confidence, self-esteem, and self-discipline.

What is a paragraph?

A paragraph is a group of related sentences that focus on a single main idea or topic. It is a unit of writing in which a writer expresses a complete thought or idea. A well-written paragraph contains a topic sentence that states the main idea, supporting sentences that provide evidence or examples, and a concluding sentence that ties the ideas together. Paragraphs are used in both fiction and non-fiction writing and are an essential component of effective communication in written form. They help to organize ideas and make writing easier to read and understand.

Here in the Question,

1. The sentence that directly states the writer's claim about jogging in the first paragraph is: "Jogging might actually trigger relief from pain and help ward off the common cold."

2. The main point, or reason, of the second paragraph is that jogging can build not only muscles but also confidence, self-esteem, and self-discipline.

3. Three specific details the writer presents as evidence are: (1) a program of regular jogging enables a runner to complete run after run while becoming stronger and more self-assured; (2) sustained running can lead to increased self-esteem through weight loss and better body image; and (3) self-discipline required for sustained running can benefit a runner's ability to stay with a task to completion.

Therefore, This passage emphasizes jogging's advantages that go beyond health benefits. The first paragraph describes how jogging might cause pain alleviation and lessen suffering from specific illnesses. The second paragraph emphasizes how jogging can increase self-discipline, confidence, and self-worth.

To learn about context clues click:

brainly.com/question/3072385

#SPJ2

Which line from The Story of My Life by Helen Keller contains imagery?

She had read his account of Laura Bridgman, and remembered vaguely that she was deaf and blind, yet had been educated. But she also remembered with a hopeless pang that Dr. Howe, who had discovered the way to teach the deaf and blind, had been dead many years. His methods had probably died with him; and if they had not, how was a little girl in a far-off town in Alabama to receive the benefit of them?

Which words from the excerpt best show the author’s use of imagery?

hopeless pang
deaf and blind
had discovered
been educated

Answers

Answer:

had discovered

Explanation:

Answer:

C

Explanation:

please give me an answer and ill give brainiest to the best one

Answers

Answer:

D. Transcendentalism

Explanation:

Transcendentalism is known to an American literary, political, philosophical, and religious movement of the early 19th century.  It lasted from about 1830 to 1860 and was a key part of the Romantic movement.

It actually centered around Ralph Waldo Emerson who was its its putative leader. The Transcendentalists are known to have believed that there is a divine spirit in nature and in every living soul. This movement postulates that human beings can reunite with God through individualism and self-reliance.

The American Romanticism was actually developed on the heels of romantic movements in Europe. Its commencement dates back to the eighteenth century. In America, it dominated the literary scene from around 1820.

Essay on "Nothing" please help its urgent​

Answers

Answer:

Nothing

Explanation:

Nothing is a word for what does not exist or meaning nothing not a thing.

Other Questions
5) In a urea manufacturing plan, all employees work a basic week of 40 hours. Ay overtime worked during weekdays is paid for at time-and-a-quarter. Overtime worked on Saturday is paid for at time-and-a-half, whilst on Sunday it is paid for at double time. If the basic rate is $14.60 per hour and a man worked 15 hours overtime during weekdays, 6 hours overtime PLEASE HELP ME!! I WILL MARK BRAINLIEST!! : Danny Duncan, David Dobrik, Nelk Boys, Danny Mullen, Steezy Kane, Or Hooligan Christian? How did the events in the reading establish Portugal as a major trading centre? What were some of the goods that the Portuguese traded? Were these different from those that the Italian merchants offered? What is inflation A. An increase in the supply of currency that reduces the currencys value B. A demand for more goods that can be met by production C. An increase in unemployment due to a serious recession D.an excess of goods that results in lower prices Multiple ChoiceWhich method adds an element at the beginning of a deque?appendleftO insertleftO popleftaddleft Which element is probably most like Carbon? and why Examine the map of major North American cities. A map titled Major Cities in North America with labels A, B, C, and D. Canada, the United states, and Mexico are labeled. A is near Washington and Canada. B is near the Pennsylvania and New York. C is in southern California. D is in Mexico. Which city is located at C? Vancouver Los Angeles Guadalajara Washington, DC GIVING BRAINLIEST!!!What were the major issues that prisoners faced in Andersonville prison? Select all that apply. (2 points)A. Water was scarce and polluted.B. Food supplies were inadequate so prisoners starved.C. Prisoners rebelled and staged an uprising.D Prison overcrowding forced prisoners to be freed early. What is the product of 417.2 x 0.64? Helppppppppppppppppppppppppppppppppp!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!! what do you mean by community based medical profession simplify by combining like terms: 3 1/9p + 5 - 1/3p How would adding the catalyst nitrogen monoxide (NO) affect this reaction?2SO2(g) + O2(g) 2SO3(g)A) NO increases the rate at which SO3 molecules are formed.B) NO reacts with SO3 to produce more SO2 molecules.C) NO decreases collisions between the SO2 and O2 molecules.D) NO increases the concentration of the SO2 and O2 molecules.E) NO increases the activation energy of the SO2 and O2 molecules. thanks guys i only got one question wrong i cant find my answer. You should really give your people the answer they are looking fo instead of giving sujestions. Write the slope-intercept equation for the graph. Energy that is stored is called... Transcribe the following DNA strand into mRNA and translate that strand into a polypeptidechain, identifying the codons, anticodons, and amino acid sequence.DNA: CGATACAATGGACCCGGTATGCGATATCC If a girl is standing still and holding a box, is she doing any work? (No)The _____ on the box is not in the same _____ as the movement