If the hydroxide ion concentration of a solution is 3.26 x 10-6 M, is it an acidic or a basic solution?

Answers

Answer 1

Answer: It is a basic solution with pH =8.51

Explanation:

We were given that hydroxide ion concentration [OH-] as 3.26 x 10-6 M

But We know thar

[OH-] [H+] = 1 × 10^-14

To get the Hydrogen ion [H+] concentration, we have that

[H+] = 1 × 10^-14 M/[OH-]

= 1 × 10^-14 M/3.26 x 10-6 M

    =  3.067 x 10^-9 M

But, pH = - log [H+]

Therefore,

pH = - log (3.067 x 10^-9)

pH=8.51

when  pH > 7, The solution is basic, therefore a solution with pH =8.51 is basic.


Related Questions

What fossil helped support Wegener's hypothesis of continental drift?

A. Gondwanaland
B. Kannemeyerid
C. Mesosaurus
D. Glossopteris

Answers

Answer:

Glossopteris

Explanation:

Glossopteris is a fossil fern that helped support Wegener's hypothesis.

Hope this helps! Have a great day!

A 4.00g sample of helium has a volume of 24.4L at a temperature of 25.0 C and a pressure of 1.00 atm. The volume of the helium is reduced to 10.4L, but the temperature and pressure of the gas are kept constant. What is the new quantity of the gas in moles

Answers

Answer:

0.852 mol

Explanation:

First we convert 4.00 g of helium (He) into moles, using its molar mass:

4.00 g ÷ 2 g/mol = 2 mol He

To answer this problem we can use Avogadro's law, which states that at constant pressure and temperature:

V₁n₂=V₂n₁

Where:

V₁ = 24. 4 Ln₂ = ?V₂ = 10.4 Ln₁ = 2 mol

We input the data:

24.4 L * n₂ = 10.4 L * 2 mol

And solve for n₂:

n₂ = 0.852 mol

fill in the blank if its true or false
T=True
F=False

_________ 1. Stars do not change over their life cycles.
_________ 2. A protostar is the latest stage of a star’s life.
_________ 3. The larger the mass, the shorter the life cycle.
_________ 4. The hottest stars are blue and the coolest stars are red.
_________ 5. The white dwarf eventually runs out of fuel and dies as a red dwarf.
_________ 6. Our Sun is in the main sequence at the moment.

Answers

Answer:  1. F

2. F

3. T

4. F

5. T

6. T

Explanation:

I am not sure i'm sorry if it isn't right

kadalasang pinupuntahan ng mga patalastas

Answers

girl whajwowowowkwow

Europe and United States use geothermal power extensively.

True
False

Answers

Answer:

True

Explanation:

US. With an installed capacity of 3,639MW in 2018, the US is the leading producer of geothermal energy across the world, producing 16.7 billion kilowatt hours (kWh) of geothermal energy throughout the year. More recently, extensive direct heat utilization projects have been undertaken in many European countries, and electric power developed extensively in Italy and Iceland. Geothermal heat pumps became extensively used in Austria, Switzerland, Germany and Sweden (Antice, Miklos and Sanner, Burkhard, 2007).

A 220.0 mL sample of helium gas is in a cylinder with a movable piston at 105 kPa and 275 K. The piston is
pushed in until the sample has a volume of 95.0 mL. The new temperature of the gas is 310 K. What is the new
pressure of the sample?
274 kPa
216 kPa
Piston
243 kPa
51.1 kPa


Answers

Answer:

Explanation:

what did you get?

Cyanobacteria, also known as blue-green algae, are a kind of bacteria found in lakes. These organisms make their own food through photosynthesis. Small animals including mayfly larvae eat the cyanobacteria, and small fish such as yellow perch eat the larvae. The small fish provide food for larger fish, such as walleye.

Choose the level of the food pyramid that represents the energy role of cyanobacteria in the lake ecosystem.

Answers

It may be the third level

A sample of 1.00 moles of oxygen at 50°C and 98.6 kPa, occupies what volume?

Answers

Answer:

27.22 dm³

Explanation:

Given parameters:

number of moles = 1 mole

temperature= 50°C, in K gives 50+ 273 = 323K

Pressure= 98.6kpa in ATM, gives 0.973 ATM

Solution:

Since the unknown is the volume of gas, applying the ideal gas law will be appropriate in solving this problem.

The ideal gas law is mathematically expressed as,

Pv=nRT

where P is the pressure of the gas

V is the volume

n is the number of moles

R is the gas constant

T is the temperature

Input the parameters and solve for V,

0.973 x V = 1 x 0.082 x 323

V= 27.22 dm³

A3.00 mol sample of CO2 (g) is in a rigid 6.00 L container at 400.°C.

Which of the following is the pressure of the gas?

16.4 atm

27.6 atm

200. atm

995 atm

Answers

Answer:

i'm thinking 27.6 not sure

Explanation:

Write two paragraphs about what would happen if your whole body was put in a low pressure environment ?

Answers

Answer:

Reduced air pressure also has a serious effect on the human body. Reduced air pressure means that there is less oxygen available to the body. For lungs to inflate, the air pressure in your lungs has to be less than the air outside the lungs. This is because air moves from high-pressure areas to low-pressure areas.

Explanation:

Reduced air pressure also has a serious effect on the human body. Reduced air pressure means that there is less oxygen available to the body. For lungs to inflate, the air pressure in your lungs has to be less than the air outside the lungs. This is because air moves from high-pressure areas to low-pressure areas.

The volume of a gas is 550 mL at 960 mm Hg and 200.0 C. What volume

would the pressure of the gas be 830 mm Hg if the temperature is reduced

to 150.0C? Make sure your answer is rounded to nearest whole number

and your final answer has the units of mL. *

Answers

Answer:

The volume will be 568.89 mL.

Explanation:

Boyle's law says that "The volume occupied by a given gaseous mass at constant temperature is inversely proportional to pressure"

Boyle's law is expressed mathematically as:

Pressure * Volume = constant

or P * V = k

Gay-Lussac's law indicates that when there is a constant volume, as the temperature increases, the pressure of the gas increases. And when the temperature is decreased, the pressure of the gas decreases. That is, the pressure of the gas is directly proportional to its temperature. Gay-Lussac's law can be expressed mathematically as follows:

[tex]\frac{P}{T}=k[/tex]

Where P = pressure, T = temperature, K = Constant

Finally, Charles's law indicates that as the temperature increases, the volume of the gas increases and as the temperature decreases, the volume of the gas decreases. In summary, Charles's law is a law that says that when the amount of gas and pressure are kept constant, the quotient that exists between the volume and the temperature will always have the same value:

[tex]\frac{V}{T}=k[/tex]

Combined law equation is the combination of three gas laws called Boyle's, Charlie's and Gay-Lusac's law:

[tex]\frac{P*V}{T} =k[/tex]

Studying an initial state 1 and a final state 2, it is fulfilled:

[tex]\frac{P1*V1}{T1} =\frac{P2*V2}{T2}[/tex]

In this case:

P1= 960 mmHgV1= 550 mLT1= 200 C= 473 K (being 0 C=273 K)P2= 830 mmHgV2= ?T2= 150 C= 423 K

Replacing:

[tex]\frac{960 mmHg*550 mL}{473K} =\frac{830 mmHg*V2}{423 K}[/tex]

Solving:

[tex]V2=\frac{423 K}{830 mmHg} *\frac{960 mmHg*550 mL}{473K}[/tex]

V2= 568.9 mL

The volume will be 568.89 mL.

What volume of solution is required to produce a 7.8M solution containing 23.6g of LiBr?

Answers

Answer:

34.9 mL

Explanation:

First we convert 23.6 g of LiBr into moles, using its molar mass (86.845 g/mol):

23.6 g ÷ 86.845 g/mol = 0.272 mol LiBr

Now we can calculate the required volume, using the definition of molarity:

Molarity = moles / litersliters = moles / Molarity0.272 mol / 7.8 M = 0.0349 L

We can convert L into mL:

0.0348 L * 1000 = 34.9 mL

Fluorine, chlorine, and bromine react with gold.
which 1 of the 3 elements will be the most reactive with gold

thanks

Answers

Answer:

gold i believe or possibly bromine

Explanation:

q- how does fluorine react with gold

a- this fluoride compound features gold in its highest known oxidation state. this red solid dissolves in hydrogen fluoride, but these solutions decompose, liberating fluorine.

q- how does chlorine react with gold

a- gold does react with halogens. it'll, for example, react very slowly with chlorine gas at room temperature to form gold chloride, AuCl3. if gold chloride is heated gently, it will decompose to release the pure elements again.

q- how does bromine react with gold

a- gold in bromine solutions dissolves according to electrochemical/chemical (EC) mechanisms. ... in the chemical composition of the mechanism, this monovalent gold bromide disproportionate into gold and stable AuBr −4 , which reports into solution. with respect to pH, there are two characteristic dissolution regions.

** sorry that i can't provide a sure answer**

good luck :)

i hope this helps

have a nice day!

Fluorine will be most reactive with gold.

What is fluorine?

Of almost all of the elements, fluorine seems to be the most electronegative as well as reactive. Fluorine would be a diatomic, pale yellow, extremely corrosive, combustible gas with a strong smell. The lightest halogen would that be. It produces oxygen and even the incredibly corrosive hydrofluoric acid when it combines strongly with water.

What is reactive?

Reactivity would be a substance's capacity to chemically combine with several other substances. Iron, for instance, reacts vigorously with oxygen.

As you move down the group, the halogens, which are non-metal elements in Group 7, become less reactive. In contrast to the alkali metals within Group 1 of the particular periodic table, this trend is the opposite. One of the most reactive elements in Group 7 was fluorine.

To know more about fluorine.

https://brainly.com/question/1940697

#SPJ3

Can carbon and hydrogen form double bonds between them?

Answers

Answer:

Carbon has four valence electrons, so it can achieve a full outer energy level by forming four covalent bonds. When it bonds only with hydrogen, it forms compounds called hydrocarbons. Carbon can form single, double, or triple covalent bonds with other carbon atoms.

The carbon-hydrogen bond (C–H bond) is a bond between carbon and hydrogen atoms that can be found in many organic compounds. This bond is a covalent bond meaning that carbon shares its outer valence electrons with up to four hydrogens. This completes both of their outer shells making them stable.

^Hope it helps, Hazel^

For a reaction to be in equilibrium.... *
A. concentration of reactants and products remain constant
B. concentration of reactants and products must be the same
C. the rate of forward reaction is not equal to the rate of backward reaction.

Answers

Answer: C) the rate of forward reaction is not equal to the rate of backward reaction. This should be the answer.

Explanation:

Which of the following is a symptom of mycoplasmosis in birds?

A. itchy rash

B. white ulcers

C. cloudy eyes

D. swollen joints

Answers

Answer:

Cloudy eyes

Explanation:

The article talks about eye infection

What is the charge of a Li ion?
A. +1
B. +2
C. -1
D.-2

Answers

Answer:

A

Explanation:

because the charge of Li ion is +1 well I don't know the explanation yet but I'm sure about the answer

The specific heat of nickel is 0.445 J/g degree Celsius. How much heat is required to heat a 168 gram piece of nickel from 15.2 degrees Celsius to 43.6 degrees Celsius?

Answers

.445 • (43.6 - 15.2) • 168 = 2123.184

ANSWER - 2123.184 J

How do properties of water break down rocks?

Answers

Answer:

Explanation:

Freezing water can break rock without any change in the minerals that form the rock (physical weathering). This usually produces small particles and sand. Water with dissolved gases and other chemicals causes the minerals in rocks to be changed, leading to the deterioration of the rock (chemical weathering).

chemical weathering

Explanation:

freezing water when mix with it cause detorilation of rocks

Exothermic reactions have _____ net bond energy.

A) positive
B) negative
C) neutral

Answers

I think it has a negative reaction.
Negative yeahhbb is the answer

the pressure of a 250.0 mL volume of gas under 4.0 atm of pressure is decreased to 1.0 atm at constant tempture what is a new volume

Answers

Answer:

1000 mL

Explanation:

The new volume can be found by using the formula for Boyle's law which is

[tex]P_1V_1 = P_2V_2[/tex]

Since we're finding the new volume

[tex]V_2 = \frac{P_1V_1}{P_2} \\[/tex]

We have

[tex]V_2 = \frac{250 \times 4}{1} = 1000 \\ [/tex]

We have the final answer as

1000 mL

Hope this helps you

An unknown amount of Al203 decomposed producing 215 g of solid aluminum. 2Al2O3=4Al+3O2 How many grams of oxygen gas should be produced

Answers

Answer:

191.11 grams of oxygen gas should be produced.

Explanation:

The balanced reaction is:

2 Al₂O₃ → 4 Al + 3 O₂

By stoichiometry of the reaction (that is, the relationship between the amount of reagents and products in a chemical reaction), the following amounts of moles of each compound participate in the reaction:

Al₂O₃: 2 molesAl: 4 molesO₂: 3 moles

Being the molar mass of each compound:

Al₂O₃: 102 g/moleAl: 27 g/moleO₂: 32 g/mole

By reaction stoichiometry, the following mass quantities of each compound participate in the reaction:

Al₂O₃: 2 moles* 102 g/mole= 204 gramsAl: 4 moles* 27 g/mole= 108 gramsO₂: 3 moles* 32 g/mole= 96 grams

Then you can apply the following rule of three: if by stoichiometry 108 grams of aluminum are produced along with 96 grams of oxygen, 215 grams of aluminum are produced along with how much mass of oxygen?

[tex]mass of oxygen=\frac{215 grams of aluminum*96 grams of oxygen}{108grams of aluminum}[/tex]

mass of oxygen= 191.11 grams

191.11 grams of oxygen gas should be produced.

This gland of the endocrine and digestive systems produces insulin to help control the body's sugar levels and enzymes which aid in digestion.

Answers

Answer:

Pancreas.

Explanation:

Living systems are self-organized life forms and are known to be very much interactive with their surroundings or environment. Also, living systems are dependent on the flow of information, matter and energy at various levels.

Some examples of living systems in organisms are respiratory system, nervous system, digestive system, and circulatory system.

Additionally, living systems comprises of the following components; cells, organs, muscle, tissues, blood, etc.

An endocrine system refers to a series of ductless glands and organs responsible for the production and secretion of hormones that are used by the body for the performance of various functions such as metabolism, controlling growth, reproduction, mood, sleep, etc. These hormones are secreted directly into the circulatory system (blood) and then transported to the organs and tissues in the body.

Pancreas is one of the glands of the endocrine and digestive systems that produces insulin to help control the body's sugar levels and enzymes which aid in digestion.

Construct an explanation for why the physical properties of the inner core, outer core, and lower mantle are essential for the development of Earth's magnetic field.

Answers

Answer:

The hot temperature of inner core and outer core is responsible for the production of magnetic field.

Explanation:

The physical properties of the inner core, outer core, and lower mantle are essential for the development of Earth's magnetic field because the very high temperature of inner core is responsible for the formation of magnetic field. If the inner core is not very hot so the magnetic field will not be generated and our earth's atmosphere will not be save from the solar wind. It can be blown away by the solar wind if this magnetic field is not present so we can conclude that the physical properties of inner core and outer core is important for the production of magnetic field.

Can someone please please help me please

Answers

Explanation:

there is what i got hope it helps. ❤❤❤❤❤

A catalyst is:
one answer only pls help lol

Answers

A catalyst is a substance that speeds up a chemical reaction.

Answer:

the second one

Explanation:

it makes the most sense

Dos objetos presentan fuerzas eléctricas repulsivas entre sí. ¿Cómo pueden ser las cargas eléctricas de estos objetos?

Answers

Answer:

Las cargas eléctricas de los objetos son ambas positivas o son ambas negativas.

Explanation:

Si dos objetos presentan fuerzas eléctricas repulsivas entre sí, quiere decir que ambos tienen el mismo tipo de carga.

Las cargas iguales (positivo con positivo, o negativo con negativo) se repelen, mientras que las cargas diferentes (positivo con negativo) se atraen.

Balance the following equation: Fe2O3 + H2O --> Fe(OH)3
A.3,2,1
B.2,2,3
C.1,3,2
D.5,2,10

Answers

Answer:

answer is c

Explanation:

hope it helps!!!

Which of the following formulas represent acids? Select all that apply.
a. NaOH
b. HCI
c. H2SO4
d. Ca(OH)2
e. KOH
f. HNO3

Answers

Answer:

B. HCl, C. H2SO4, F. HNO3

Explanation:

Acids have hydrogen (H) at the beginning

bases have OH at the end

HCl, H₂SO₄,HNO₃ are the chemical formulas which represent acids.

What are acids?

Acids are defined as substances which on dissociation yield H+ ions , and these substances are sour in taste. Out of the following , given sets of compounds HCl, H₂SO₄ and HNO₃ are acids as they yield H+ ions on dissociation.

According to the number of H+ ions which are generated on dissociation acids are classified as mono-protic , di-protic ,tri-protic and polyprotic  acids  depending on the number of protons which are liberated on dissociation.

Acids are widely used in industries  for  production of fertilizers, detergents  batteries and dyes.They are used in chemical industries for production of chemical compounds like salts which are produced by neutralization reactions.

Learn more about acids,here:

https://brainly.com/question/13586622

#SPJ2

PLZ HELP!

Where have you seen or known of examples of waves in YOUR LIFE? Based on science terms of a wave.

Answers

Answer:

QUESTION:

Where have you seen or known of examples of waves in YOUR LIFE? Based on science terms of a wave.

ANSWER:

I've seen the following in my life:

~ Lightwaves

~ Heatwaves

~ Electromagnetic waves

~ X-rays

~ Tsunami Waves

Explanation:

Hope that this helps you out! :)          

If you have any questions please put them in the comment section below this answer.          

Have a great rest of your day/night!          

Please thank me on my profile if this answer has helped you.  

Other Questions
Write the relationship between cells, tissue and organs in human body.(plzzzzz answer correctly) At an auto repair shop. 3.5 hours of labour costs $311.50. What is the labourcharge for a 5 hour job? can somebody help please 4. How are the main narrator and Simon Wheeler different? Give as many details aspossible. The Dust Bowl of the 1930s was caused by_______(choose multiple answers) earthquakesvolcanic eruption erosion overgrazing the clearing of grasslands fertilizer runoff The writer Angelo Pellegrini has recalled his own family's detention at Ellis Island:We lived there for three days -- Mother and we five children, the youngest of whom was three years old. Because of the rigorous physical examination that we had to submit to, particularly of the eyes, there was this terrible anxiety that one of us might be rejected. And if one of us was, what would the rest of the family do?The purpose of this excerpt is..A. to describe the physical examination experienced by an immigrant family.B. to explain the day-to-day schedule experienced by an immigrant family.C. to describe the fond memories experienced by an immigrant family.D. to explain the feelings of worry experienced by an immigrant family. What fossil helped support Wegener's hypothesis of continental drift?A. GondwanalandB. KannemeyeridC. MesosaurusD. Glossopteris Puteti sa ma ajutati va rog 2What does Don Pepe's lesson to Nayeli in paragraph 13 reveal about theirrelationship?A. He was protective of her and did not want to worry her about life's difficulties.B. He thought she would be able to understand complicated ideas.C. He found her annoying and wanted to limit their conversations.D. He was interested in unusual trivia and wanted to share it with her. What is wrong with the claim statement: "Everyone should use a cell phone." In the circular flow model, businesses provide goods and services to whichpart of the economy?A. BusinessesB. Product marketsC. Resource marketsO D. Households PLEASE HELP WILL GIVE BRAINLIEST!! Please please only answer if you know or can help!! I need help know if what i already put is correct or how i can fix it and also the answer to question E. THANK YOU! Please help! Thank you! what is the mRNA in TACCGGATGCCAGATCAAATC? Help!!! I do not seem to understand this problem well. Dr. Seals borrows $15,000 to remodel her backyard. The interest rate is 3%. The interest is compounded twice a year for two years. Why would an investor want to choose a certificate of deposit over a corporate bond describe how the state of Washington and its residents played a huge part in winning World War II? Plzzz help NEED THIS FAST!!! Layla is going to invest $5,200 and leave it in an account for 15 years. Assuming the interest is compounded monthly, what interest rate, to the nearest tenth of a percent, would be required in order for Layla to end up with $13,800? Most Americans consume a varied diet. They eat foods that are both plant- and animal-based. Which words are clues to the meaning of the word consume? A. are both B. eat foods C. animal-based D. Most Americans