If you were to find 2 fossils, give the reasons for the way you might be able to tell which fossil is older?

Answers

Answer 1

Answer:

Relative Dating

Explanation:

Relative dating is used to determine a fossils approximate age by comparing it to similar rocks and fossils of known ages. Absolute dating is used to determine a precise age of a fossil by using radiometric dating to measure the decay of isotopes, either within the fossil or more often the rocks associated with it.


Related Questions

describe the human condition before Science and technology was practice.​

Answers

Their condition was very very bad .doing everything by themselves

Diana has just been diagnosed with "pre-diabetes," and her doctor has instructed her to watch her intake of sugar. This is easy at home, but this weekend she will be going to a restaurant with her family. What should she do? (1 point) Order anything on the menu labeled "sugar-free" or "fat-free." Use a phone app to check the sugar content in items or ingredients on the menu. Order something off the salad options and skip the soda or dessert. Split an entrée with a friend to reduce her calorie intake at the meal.

Answers

Answer:

sugar free

Explanation:

she should most likely take anything sugar free and avoid any bread, bread can increase your blood level as well, my mother had pre diabetes and what she did was eat salads and drink vegetable smoothies until your sugar goes down. splitting an entrée won't do anything, you technically get the same amount of sugar so at the point just eat the whole meal.

Which of these is an example of tertiary prevention?
A. Getting screened for skin cancer
B. Avoiding smoking and drinking alcohol
C. Dialysis for damaged kidneys
D. Washing hands

Answers

Explanation:

because a tertiary prevention is when the person is already infected with the disease

Because a tertiary prevention is when the person is already infected with the disease

why does ice melt faster in water than in oil when both liquids are at the same temperature​

Answers

Water has a high specific heat capacity. Oil has a smaller heat capacity.

Answer:

Because water has a high specific heat, each little bit of water flowing past can give lots of thermal energy to the ice cube. Oil has a smaller specific heat, and so more oil has to flow past to give the same amount of heat energy to the ice cube. ... Colder oil will melt ice less rapidly than warmer oil or water

41. 2072 Set E Q.No. 11 A source of sound produces a note of
512 Hz in air at 17°C with wavelength 66.5 cm. Find the ratio
of molar heat capacities at constant pressure to constant
volume at NTP. Densities of air and mercury at NTP are
1.293 kg/m3 and 13600 kg/m3 respectively.
Ans: 1.36​

Answers

A. is the answer for this

A woman has one damaged fallopian tube. The damage completely blocks the opening of the tube at the ovary. How will this most likely affect her fertility?
Her likelihood of conceiving will be reduced by at least 50%.
Her eggs, if fertilized, will not implant properly.
Her eggs will not mature inside the ovary.
Her chances of conceiving twins will be doubled.

Answers

Answer:Her likelihood of conceiving will be reduced by at least 50%.

Explanation:

EDGE 2020

Answer:

Her likelihood of conceiving will be reduced by at least 50%

Explanation:

took the test on edge, got it right

Calculate the magnitude of the electric field at one corner of a square 2.42 m on a side if the other three corners are occupied by 2.75×10−6 C charges.

Answers

Answer:

loloeuhsh

Explanation:

shwvwgnwajejjeisus

A hunter on a frozen, essentially frictionless pond uses a rifle that shoots 4.20 gg bullets at 970 m/sm/s. The mass of the hunter (including his gun) is 69.5 kgkg, and the hunter holds tight to the gun after firing it. You may want to review (Page) . For related problemsolving tips and strategies, you may want to view a Video Tutor Solution of Collision along a straight line. Part A Find the recoil speed of the hunter if he fires the rifle horizontally.

Answers

Answer:

[tex]0.059\ \text{m/s}[/tex]

Explanation:

[tex]m_1[/tex] = Mass of bullet = 4.2 g

[tex]u_1[/tex] = Initial velocity of bullet = 0

[tex]m_2[/tex] = Mass of hunter with rifle = 69.5 kg

[tex]u_2[/tex] = Initial velocity of hunter with rifle

[tex]v_1[/tex] = Final velocity of the bullet = 970 m/s

[tex]v_2[/tex] = Final velocity of the hunter with the rifle

As the momentum of the system is conserved we have

[tex]m_1u_1+m_2u_2=m_1v_1+m_2v_2\\\Rightarrow v_2=\dfrac{m_1u_1+m_2u_2-m_1v_1}{m_2}\\\Rightarrow v_2=\dfrac{0-0-0.0042\times 970}{69.5}\\\Rightarrow v_2=-0.059\ \text{m/s}[/tex]

The recoil speed of the hunter is [tex]0.059\ \text{m/s}[/tex] in the opposite direction of the bullet.

You and a friend are playing with a bowling ball to demonstrate some ideas of Rotational Physics. First, though, you want to calculate the Rotational Kinetic Energy of the bowling ball as it rolls down a sidewalk without slipping. This means it has both linear kinetic energy and rotational kinetic energy. A bowling ball can be modeled as a solid sphere rotating about its center. This bowling ball has a mass of 6.40 kg and a radius of 0.130 m. You'll need to look up the equation for the Moment of Inertia in your textbook. It is rotating with an angular velocity of 16.0 radians / second in the counter-clockwise (or positive) direction. You can use this to determine the linear velocity of the bowling ball (since it is rolling without slipping). What is the Total Kinetic Energy of the bowling ball

Answers

Answer:

K_{total} = 19.4 J

Explanation:

The total kinetic energy that is formed by the linear part and the rotational part is requested

         [tex]K_{total} = K_{traslation} + K_{rotation}[/tex]

let's look for each energy

linear

        [tex]K_{traslation}[/tex] = ½ m v²

rotation

        [tex]K_{rotation}[/tex] = ½ I w²

the moment of inertia of a solid sphere is

       I = 2/5 m r²

we substitute

       [tex]K_{total}[/tex] = ½ mv² + ½ I w²

           

angular and linear velocity are related

           v = w r

we substitute

           K_{total} = ½ m w² r² + ½ (2/5 m r²) w²

           K_{total} = m w² r² (½ + 1/5)

           K_{total} = [tex]\frac{7}{10}[/tex] m w² r²

let's calculate

           K_{total} = [tex]\frac{7}{10}[/tex]   6.40 16.0² 0.130²

           K_{total} = 19.4 J


Give the relationship between the number of valence electrons in an atom's
valence electron shell and the position of the element on the Periodic Table​

Answers

Answer:

they're reactions

Explanation:

The relationship between the valence electrons and position is: the number of valence electrons determines the position

What is valence electron?

This is the number of electrons in the outermost shell of an atom.

NOTE: The outermost shell is called valence shell

Position in Periodic table

This is where an element is located in the periodic table

Relationship between valence electrons and position

The position of an element in the periodic table is determined by the number of valence electrons.

For example

Sodium, Na (atomic number of 11) has the following electronic configuration

1st shell = 2 electrons2nd shell = 8 electrons 3rd (valence) shell = 1 electron

Since the valence electron is 1, thus, sodium is located in group 1 of the periodic table.

Thus, we can see that the position of an element in the periodic table is related to the valence electron(s) in the atomic shell of the element.

Learn more about valence electron:

https://brainly.com/question/13993867

#SPJ2

Why is no image formed when an object is at the focal point of a converging lens?

Answers

Answer:

the refracted rays neither converge nor diverge. After refracting, the light rays are traveling parallel to each other and cannot produce an image.

Explanation:

An object has a mass of 50 kg on Earth. What would be the mass of that object in the Moon

Answers

It would be 50 kg.

Mass doesn't change.

Weight can.

How does Newton’s first second and third laws apply to eating your breakfast

Answers

Answer:

Newton's third law states that for every action (force) in nature there is an equal and opposite reaction. In other words, if object A exerts a force on object B, then object B also exerts an equal and opposite force on object A. Notice that the forces are exerted on different objects. However much you push your fork in the food, that much a dent it will cause.

Explanation:

Answer:

¡I hope it helps you! :) .................

follow the chain of energy from a plant to a person riding a skateboard. explain what type of energy is being used at each step.
PLEASE HELP!!!!

Answers

Answer:

A⁣⁣⁣⁣nswer i⁣⁣⁣s i⁣⁣⁣n a p⁣⁣⁣hoto. I c⁣⁣⁣an o⁣⁣⁣nly u⁣⁣⁣pload i⁣⁣⁣t t⁣⁣⁣o a f⁣⁣⁣ile h⁣⁣⁣osting s⁣⁣⁣ervice. l⁣⁣⁣ink b⁣⁣⁣elow!

bit

.ly

/3a

8Nt8

please help asap

Ms. Brando’s students are studying forces. She has assigned a fun task: designing a balloon car. The students must design a car and see which model will travel the greatest distance. The basic design of the cars can be seen here. First the balloon is inflated and attached to the car. It is important to keep the balloon closed. Once attached to the car, the stem of the balloon is opened and air rushes out through the straw. The air goes one way; the car moves in the other direction. There are no restrictions on the design other than the students must use the materials given to them by Ms. Brando. What is the source of the force that moves the car? A) The circumference of the balloons. B) The friction between the wheels and the track surface. C) The air rushing out of the balloon through the straw. D) The mass of the car: the lighter the car the farther it moves.

Answers

Answer: a

Explanation:

when a car dives on a road it a makes friction but it need something to push it or start it which is the balloon in this example

(sorry if im wrong)

Fizik
Dua perintang 5 Ω dan 10 Ω disambung selari dengan 9 V bekalan kuasa. Kira kuasa output bekalan kuasa.​

Answers

Answer:

P = 24.32 W

Explanation:

The question is, "Two resistors 5 Ω and 10 Ω are connected in parallel with a 9 V power supply. Calculate the output power of the power supply.".

The voltage of the power supply, V = 9 V

Resistor 1, R₁ = 5 Ω

R₂ = 10 Ω

The equivalent of parallel combination of resistors is given by :

[tex]\dfrac{1}{R_{eq}}=\dfrac{1}{R_1}+\dfrac{1}{R_2}\\\\\dfrac{1}{R_{eq}}=\dfrac{1}{5}+\dfrac{1}{10}\\\\R_{eq}=3.33\ \Omega[/tex]

The power of the output is given by :

[tex]P=\dfrac{V^2}{R_{eq}}\\\\=\dfrac{9^2}{3.33}\\\\P=24.32\ W[/tex]

So, the output power is equal to 24.32 W.

What is the female counterpart of sperm?
the vagina
the ovum
the zygote
the epididymus

Answers

Answer:

The zygote

Explanation:

The sperm is what fertilized the egg and the zygote is basically part of the female egg cell.

Hope this Helps!Hope this Helps!:)

Answer:

the answer is the ovum on edge

Explanation:

Read each example and identify whether the data are observations or inferences from observations. The fish’s ventral fin measured 8.5 cm long.

Answers

8.5 cm long just bc we love this

Answer:

Observation

Inference

Inference

Observation

Inference

Explanation:

explain why a diver at the bottom of the sea feels more pressure than one who is swimming on the surface of water​

Answers

As you go more further down the water the pressure increases. The deeper diver goes the more water will be above them. Meaning, they will experience more pressure than person who is swimming at the surface water.

Answer:

the deeper into the ocean you go, the more pressure is exerted on you

Explanation:

A car on a roller coaster loaded with passengers has a mass of 2.0 x 10^3 kg. At the lowest point of the the track, the radius of curvature is 24 m and the roller coaster car has a tangential speed of 17 m/s

Answers

We have that the  is mathematically given as

Fn=36000N

Force

Question Parameters:

mass of 2.0 x 10^3 kg

the radius of curvature is 24 m and

the roller coaster car has a tangential speed of 17 m/s

Generally the equation for the Force   is mathematically given as

F=ma

Fn-fg=mv^2/r

Fn=m(v^2/r+g)

Therefore

Fn=2000(12^2/18+9.8)

Fn=36000N

For more information on Force visit

https://brainly.com/question/26115859

Lithium was one of the metals studied by the American physicist Robert Millikan in his research on the photoelectric effect. When illuminated with blue light of frequency 6.64 x 10" Hz, the photoelectrons ejected from a lithium surface have a maximum kinetic energy of 0.332 eV. What is the threshold frequency for lithium? For this problem, let the value of Planck's constant, h, be 6.63 x 10J's

Answers

Answer:

 f = 7.9487 10¹³ Hz

Explanation:

The photoelectric effect was correctly explained by Einstein assuming that the radiation is composed of photons, which behave like particles.

           hf = K + Ф

It indicates the frequency and the kinetic energy, let's look for the work function

          Ф = hf - K

let's reduce the magnitudes to the SI system

          K = 0.332 eV (1.6 10⁻¹⁹ J / 1 eV) = 0.5312 10⁻⁻¹⁹ J

let's calculate

          Ф = 6.63 10⁻⁻³⁴  6.64 10¹¹ - 0.5312 10⁻¹⁹

          Ф = 4.40 10⁻²² - 0.5312 10⁻¹⁹

          Ф = 5.27 10⁻²⁰ J

for the minimum frequency that produces photoelectrons, the kinetic energy is zero

           hf = Ф  

           f = Ф / h

           f = 5.27 10⁻²⁰ / 6.63 10⁻³⁴

           f = 7.9487 10¹³ Hz

An 85-year-old woman who was having trouble breathing checked into the hospital. There, her heart stopped beating and doctors determined she suffered heart failure. After being resuscitated, she was in a coma and had no brain function. Her family then made the difficult decision to take her off life support, and the woman passed away.

Which order of events did the woman experience?
brain death Right arrow. clinical death Right arrow. somatic death
somatic death Right arrow. brain death Right arrow. clinical death
clinical death Right arrow. brain death Right arrow. somatic death
clinical death Right arrow. somatic death Right arrow. brain death

Answers

Answer:c

Explanation:

clinical death Right arrow. brain death Right arrow. somatic death this order of events did the woman experience. Hence option C is correct.

What is death ?

The permanent end of all biological activities that support an organism is defined as death. Death may also be defined as the permanent cessation of functioning of the entire brain, including the brainstem, in creatures with a brain, and brain death is frequently used as a legal definition of death.Normally, the remnants of a previous creature begin to degrade quickly after death. Death is an unavoidable process that happens in all species. Turritopsis dohrnii, for example, is physiologically immortal. They can, however, perish from causes other than ageing.

It has been difficult to determine when someone has died. Initially, death was defined as the cessation of breathing and heartbeat.

To know more about Death :

https://brainly.com/question/31108171

#SPJ3.

Will give brainliest!!

How much KClO3 is needed to make a saturated solution in 100 mL of water at 70⁰ C?

Answers

Answer:

iam not sure but I think its NaNO3

An example of conservation of angular momentum is jumping on a Merry-Go-Round. Watch this video (it starts part way through but the only thing you miss is the people pushing the Merry-Go-Round) to see someone jumping on a Merry-Gr-Round in motion like this problem. You can model the Merry-Go-Round as a solid disk with a radius of 2.70 m and a mass of 77.0 kg. Initially the Merry-Go-Round has an angular velocity 7.40 radians / second. Then the person jumps on and change the Moment of Inertia of the system. The person lands on the outer edge of the Merry-Go-Round and has a mass of 58.0 kg. What is the final angular velocity of the system after the person jumps on

Answers

Answer:

ωf = 2.95 rad/sec

Explanation:

Assuming no external torques acting while the person jumps on, total angular momentum must be conserved.Angular momentum for a rotating rigid body can be expressed as follows:

       [tex]L = I * \omega (1)[/tex]

where I = moment of inertia regarding the rotating axis, and ω= angular velocity.Since total angular momentum must be conserved, this means that the following equality must be satisfied:

       [tex]L_{o} = L_{f} (2)[/tex]

The initial angular momentum, taking into account that the Merry-Go-Round can be modeled as solid disk, can be expressed as follows:

        [tex]L_{o} = I_{o} * \omega_{o} = \frac{1}{2}* M* R^{2}* \omega_{o} =\\ \frac{1}{2} * 77.0 kg* (2.70m)^{2}* 7.40 rad/sec = 2076.92 kg*m2*rad/sec (3)[/tex]

The final angular momentum, is just the product of the new moment of inertia times the final angular velocity.The new moment of inertia, is just the sum of the original moment of inertia I₀ and the moment of inertia due to the person that jumps on.Assuming that we can treat him as a point mass, his moment of inertia is just the product of his mass times to the distance to the axis of rotation (the radius of the Merry-Go-Round) squared.So, we can write the new moment of inertia If as follows:

       [tex]I_{f} = I_{o} +( m_{p} * R^{2}) = (\frac{1}{2} * M* R^{2}) + ( m_{p} * R^{2}) =\\ (\frac{1}{2} * 77.0 kg* (2.70m)^{2}) +( 58.0 kg * (2.70m)^{2}) = \\ 280.67 kg*m2 + 422.82 kg*m2 = \\ 703.49 kg*m2 (4)[/tex]

The final angular momentum can be written as follows:

        [tex]L_{f} = I_{f} * \omega_{f} (5)[/tex]

Since (3) and (5) must be equal each other, replacing If by its value from (4) in (5), we can solve for ωf, as follows:

       [tex]\omega_{f} = \frac{L_{o} }{I_{f}} = \frac{2076.92kg*m2*rad/sec}{703.49kg*m2} = 2.95 rad/sec (6)[/tex]

What is the frequency of a wave that has a speed of 500 m/s and a wavelength of 12m?

Answers

Answer:

41.7 Hz

Explanation:

Wavelength= velocity/frequency

or

frequency= velocity/Wavelength

f=500/12

f=41.6666

f=41.7 Hz

Please like and rate. Tnks

As an admirer of Thomas Young, you perform a double-slit experiment in his honor. You set your slits 1.01 mm apart and position your screen 3.09 m from the slits. Although Young had to struggle to achieve a monochromatic light beam of sufficient intensity, you simply turn on a laser with a wavelength of 639 nm . How far on the screen are the first bright fringe and the second dark fringe from the central bright fringe

Answers

Answer:

[tex]0.00195\ \text{m}[/tex]

[tex]0.00293\ \text{m}[/tex]

Explanation:

m = Order = 1

D = Distance between screen and slit = 3.09 m

d = Slit distance = 1.01 mm

[tex]\lambda[/tex] = Wavelength = 639 nm

Distance from the first bright fringe from the central bright fringe is given by

[tex]y=\dfrac{m\lambda D}{d}\\\Rightarrow y=\dfrac{1\times 639\times 10^{-9}\times 3.09}{1.01\times 10^{-3}}\\\Rightarrow y=0.00195\ \text{m}[/tex]

Distance from the first bright fringe from the central bright fringe is [tex]0.00195\ \text{m}[/tex]

Distance from the second dark fringe from the central bright fringe is given by

[tex]y=(m+\dfrac{1}{2})\dfrac{\lambda D}{d}\\\Rightarrow y=(1+\dfrac{1}{2})\dfrac{639\times 10^{-9}\times 3.09}{1.01\times 10^{-3}}\\\Rightarrow y=0.00293\ \text{m}[/tex]

Distance from the second dark fringe from the central bright fringe is [tex]0.00293\ \text{m}[/tex].

HELP PLZZZZZ
Vitiligo is an example of a condition that comes from
A. your habits
B. your predisposed genetics
C. your social network
D. your physical environment

Answers

B. your predisposed genetics

Answer:

the answer is b vitiligo is a genetic skin condition

the speed of light in a certain medium is 0.6c. find critical angle , if the index of refraction is 1.67​

Answers

Answer:

[tex]\theta_c = 36.78^o[/tex]

Explanation:

The relationship between the refractive index and the critical angle is given as follows:

[tex]\eta = \frac{1}{Sin\ \theta_c} \\\\Sin\ \theta_c = \frac{1}{\eta}\\\\\theta_c = Sin^{-1}(\frac{1}{\eta} )[/tex]

where,

η = refractive index = 1.67

θc = critical angle =?

Therefore,

[tex]\theta_c = Sin^{-1}(\frac{1}{1.67} )[/tex]

[tex]\theta_c = 36.78^o[/tex]

what does chucking do for your memory

Answers

Answer:

By separating disparate individual elements into larger blocks, information becomes easier to retain and recall. This is due mainly to how limited our short-term memory can be. ... Chunking allows people to take smaller bits of information and combine them into more meaningful, and therefore more memorable, wholes.




HELP PLEASE
Two 24 ohm resistors are in parallel and placed across a 12 V battery. What is the current in each branch of the circuit?
20 A
0.0125 A
0.5 A
.

Answers

Answer:

.5 A

Explanation:

Other Questions
Item 3How does the setting of the afterlife in "Orpheus and Eurydice" differ from that in "Valhalla: Hall of the Chosen Slain"?In "Orpheus and Eurydice," the afterlife is about punishment, while in "Valhalla: Hall of the Chosen Slain," it is based on pleasure.In "Orpheus and Eurydice," the afterlife is like a vacation, while in "Valhalla: Hall of the Chosen Slain," it is nothing but hard work.In "Orpheus and Eurydice," the afterlife is torturous, while in "Valhalla: Hall of the Chosen Slain," it is relaxing.In "Orpheus and Eurydice," the afterlife is gloomy and calm, while in "Valhalla: Hall of the Chosen Slain," it is wild and riotous. hi can you please help me with my work When identifying the agent responsible for causing a disease, why is evaluation of colony morphology not enough? Add the two functions. f(x) = 3x3 + 7x 26 g(x) = x + 2 Classify the real number.[tex] \sqrt{15} [/tex] Please help! Thank you! The image below shows anti-Castro forces launching an attack during the Bay of Pigs invasion in 1961. What type of response does this image illustrate? Diplomacy Isolation Intervention Trade Help me please! I will mark brainliest for whoever gets it right the fastest. HELP mE need math help 20 points no links or imma report HeLP mE Find the area of the white region in the diagram shown. Mason wants to play with Maliyah's Doll House, but first he needs to stop at the clubhouse. If allthree stops are in the shape of a triangle, which of the following distances would NOT be an option? The sum of three consecutive integers is -27 what is the product of the smallest and largest of the three integers? what is the mRNA in TACCGGATGCCAGATCAAATC? pinocchio says my nose will grow. will it grow or not?dun dun dun what is (-10,10) if i dilate it by 1/2 a cup of coffee is left to cool inside a room and its cooling can be described by the function y = 85(.75)x/5 + 15 where x is time in minutes and t is the temperature of the coffee in degrees celsius. The height of a cylinder is 8 centimeters. The circumference of the base of the cylinder is 20 centimeters. Which measurement is closest to the volume of the cylinder in cubic centimeters? Help!!! I do not seem to understand this problem well. HELP MEEE BRAINLIEST do this for me? helppp all my point