ILL GIVE BRAINLEIST
Read this introductory paragraph from a student essay and then answer the question.

(1) Have you ever felt great fear but decided to face that fear anyway? (2) There is no single definition of courage and more than one way to show it. (3) In Heart of a Samurai, Manjiro is faced with grave dangers. (4) In The Boy Who Harnessed the Wind, William must overcome disbelief and ridicule. (5) Both heroes show tremendous courage.

Which choice best revises sentence 4 so that it contains supporting details?

In The Boy Who Harnessed the Wind, William must overcome disbelief and ridicule, which is extremely difficult for him at this point in his life.
In The Boy Who Harnessed the Wind, William must overcome the disbelief and ridicule of his neighbors to complete his passion project, building a windmill.
In The Boy Who Harnessed the Wind, William must overcome disbelief and ridicule, which is something we all must do at points in our lives.
In The Boy Who Harnessed the Wind, William must overcome disbelief and ridicule, and read books about windmills in a language he does not know very well.

Answers

Answer 1

Answer:

b

Explanation:


Related Questions

What is composition?

answer: B. How the objects in a photograph are positioned

A. The way in which light is used in an image or video

B. How the objects in the photograph are positioned

C. A small, compressed file that contains visual data

D. A tool used for trimming parts of a video or image​

Answers

B. How the objects in the photograph are positioned

Please answer as soon as possible,thanks.

Answers

Answer:

I WOULD SAY ITS B

Explanation:

According to michael bechloss, what makes a good speech?

Answers

Answer:

Historian and author Michael Beschloss used examples of five historic inaugural addresses to discuss what makes an effective inaugural address. He cited the inaugural address of Lincoln (1865), Roosevelt (1933), Kennedy (1961), Reagan (1981), Bush (2001), and Obama (2009).

At Cindy's birthday each guest will get one-third of a medium sized pizza. There
will be 12 people at the party, including Cindy. How many pizza's does her mom
need?

Answers

Answer:

36

Explanation:

12 divided by 1/3= 36

What are the four parts
of a paragraph

Answers

The introduction, body, body 2 and than your conclusion. I’m pretty sure

what does katniss call the tributes from the wealthier districts and why?

(also what page the answer was found in) ​

Answers

Answer:

As Katniss explains, the Career Tributes are those tributes from the wealthier districts (typically Districts 1, 2, and 4) who have trained their whole lives to take part in the Hunger Games. ... As a result, they are generally better prepared for the challenges of the Hunger Games and are typically the winners.

What do the words mouse and menu have in common?

Answers

Answer:

They both start with M???

Explanation:

Read this excerpt from Night by Elie Wiesel.

Then the train resumed its journey, leaving in its wake, in a snowy field in Poland, hundreds of naked orphans without a tomb.

What does the image in this excerpt refer to?

the fact that the burial grounds in Poland are already full

the Polish children who no longer have parents

the train’s route through a snowy cemetery

the many abandoned bodies that cannot be buried

Answers

The answer is “The many abandoned bodies that cannot be buried” The reason for this is because the book is about the Holocaust and since they would kill them in such a vast amount and since they didn’t care for them they would just pile up the bodies.

How did the struggles of black women during the Civil Rights Movement compare to the struggles of black men?

Answers

Many women played important roles in the Civil Rights Movement, from leading local civil rights organizations to serving as lawyers on school segregation lawsuits. Their efforts to lead the movement were often overshadowed by men, who still get more attention and credit for its successes in popular historical narratives and commemorations. Many women experienced gender discrimination and sexual harassment within the movement and later turned towards the feminist movement in the 1970s. The Civil Rights History Project interviews with participants in the struggle include both expressions of pride in women’s achievements and also candid assessments about the difficulties they faced within the movement.

what is the theme of poet x ?

Answers

Answer:

Explanation:

The main characters in Elizabeth Acevedo's The Poet X include the titular character, "X" (which is the stage name that the fifteen-year-old Xiomara Batista adopted in her slam poetry group). X lives in Harlem with her family and is self-conscious about her curvy body, which elicits comments from men. She is torn between her mother's wishes that she eschew dating and men in favor of the church, and her burgeoning interest in the art of poetry.

What figurative language is this? She said "Granddaddy was the biggest liar god ever blew breath into"

Answers

Answer:

Hyperbole

Explanation:

Answer:

Hyperbole

Explanation:

It is exaggerating that he was the BIGGEST liar.

Aha!” cried he. "Here is plenty of food for all. No more need to starve." "Hush," said his cousin. "You must not shout here. The place is too wonderful. Sit down quietly and eat.”

Which provides a summary of the selection?

A. One cousin finds a magic stone but refuses to share it with the other.

B. Two cousins disagree about how to use a magic stone and finally sell it.

C. Two cousins disagree on how to feed their families and finally go hungry.

D. One cousin uses a magic stone wisely while the other loses it due to greed.​

Answers

Answer:

A

Explanation:

because the cousin wanted to more food.

Answer:

d

Explanation:

if that is all for that question then it could be d cause later on it said kofi had taken enough for his family while spider had taken it

a doesn't make much sense cause kofi had refused because it said spider was wicked, but still took enough for their family, with b and c it didn't say anything about a disagreement which leaves d

Why did Manuel sell buck in the call of the wild?Why did people want to buy dogs like buck? plz hurry​

Answers

Answer:

Manuel kidnaps Buck because he want to make money out of him by selling him. Manuel needs this money to fund his gambling habit, and also he has a large family to provide for.

Explanation:

If you were shorter than someone, would it be possible to talk down to them?​

Answers

Answer:

yes

Explanation:

stand on a ladder

Answer:

yes

Explanation:

What effect does this speech have on George, Sam, and Rameck? They are shocked to hear about the varied quality of care. They are inspired and determined to make a difference. They are confused and eager to make sense of the situation. They are skeptical and quick to question the speaker.

Answers

Answer

what are the answers?

Explanation:

it could be b " they inspired and determined to make a difference" just doing that question

Answer:

it is b

Explanation:

because after they herd him say that they felt that they were ready and determined to change the world and help those in need

Without another word, the very disappointed customer laid the money on the counter and left the store. He had learned not only that he who squanders his own time is foolish, but that he who wastes the time of others is a thief.

Which summarizes the selection?

A. A customer insisted on arguing about the price of a book with the owner, caring little for the interruption he caused.

B. A customer spent a great deal of time browsing in a bookstore and then insisted on seeing Franklin.

C. A customer thought the owner of the bookstore would give him a better price than the clerk.

D. A customer learned that Franklin valued his time more than he valued customer satisfaction.​

Answers

Answer:

A. A customer insisted on arguing about the price of a book with the owner, caring little for the interruption he caused.

Name three predators of the Capybara​

Answers

Explanation:

A constant source of water is important to capybaras, who retreat into murky waters to escape from predators like jaguars, anacondas, caimans, pumas, ocelots, and harpy eagles. Capybaras are physically well-adapted to a semi-aquatic lifestyle.

Answer:

Caimans, ocelots, harpy eagles, and anacondas are the predators of the Capybara, hope it helps

Social media have the ability to spark revolutions, such as the one in Egypt in 2011, because social media:


A. allow many people to organize quickly.

B. were created to spark revolutions and protests.

C. are provided by antigovernment organizations.

D. often censor antigovernment posts or emails.​

Answers

Answer:A

Explanation:

how can we say that junk food has become a global culture.​

Answers

Answer:

Junk food has become a global culture because it is convenient and you can basically eat it anywhere.

Explanation:

In this modern day and age, people are always busy, no matter what your job/work is. Because of this work environment, maintaining health is not a priority. Just thinking about eating and munching down food is enough for an average person without looking out for the health components of the food. At the end of the day, we want something sweet, something we crave. Health is not a huge motivator in that time frame. Junk food has also been very convenient when it comes to emotional fulfillment. You can just much on it while wallowing in all of your problems and quite frankly, it can be a great companion. Not for your bodily systems though.

After leaving Stratford, and moving to London, what profession did Shakespeare hold?

Answers

Answer: His theatre work was in London but he was often with his family in Stratford, where he also attended to his business interests. He accumulated a property portfolio in both places while participating in the management of several theatres and acting companies in London.

Hope this helps.

Explanation:

What are two characteristics of expository text?

Answers

Answer:Informative. Expository text is meant to deposit information.

Clarity. Using words that clearly show what the author is talking about.

Explanation:

Which term best identifies A Christmas Carol?

a.novella

b.book

c.novel

d.story

Answers

Answer:

A

Explanation:

A Christmas Carol is a Novella because the whole book focuses on different times of his life an experience. when you search the book the first result is from wikipedia under the novella genre.


if this helped feel free to give brainliest and have a great day!

1) How does Citra's thoughts on not being
Scythe material create irony in the text?

Answers

aye man ion em knoExplanation:

9. Lady Macbeth greets Duncan
A. with undisguised jealousy and ambition
B. and advises him on affairs of his kingdom
C. as a perfect hostess would greet a guest
D.with news of Macbeth's failure to arrive

Answers

C. As a perfect hostess would great a guest

To prepare for the test, Andrew takes notes and studied.

Which answer corrects the error in verb tense?

Question 1 options:

To prepare for the test, Andrew took notes and studied.


To prepare for the test, Andrew was taking notes and is studying.


To prepare for the test, Andrew took notes and is studying.


To prepare for the test, Andrew takes notes and will study.

Answers

To prepare for the test, Andrew took notes and studied.

Please which one is the right answer

Answers

Answer:

a

Explanation:

maby

Answer:

The last one is the answer so you are correct.

Explanation:

Who is Mustafizur Rahman ?

Answers

Answer:

Mustafizur Rahman (born 6 September 1995) is a Bangladeshi international cricketer. He is specialized as a left-arm fast-medium bowler. He has taken the most wickets (13) in a debut One Day International (ODI) series. He is the first player to win the ‘Man of the Match’ award on both Test as well as ODI debuts.

Answer:

left-arm fast bowler

Mustafizur Rahman is a left-arm fast bowler and he plays for Bangladesh National Cricket Team. He recently started his International Cricket career but this few times, Mustafizur established himself as a famous Bowler in the world.

Explanation:

this insect as useful as harmful as well as there . rearrange it

Answers

Answer:

is this a riddle or what im confused edit the question and add more detail then ill answer it for u but im lost sorry :/

why do anne and peter have different perspectives on their star? what does this tell you about anne? diary of anne frank

Answers

Answer:

Several humanitarian organizations are devoted to her legacy. "Anne was a lively and talented girl, expressing her observations, feelings, self-reflections, fears, hopes and dreams in her diary," said Annemarie Bekker of the Anne Frank House in Amsterdam. "Her words resonate with people all around the world."

Question 2 of 12
Which sentence is worded correctly and avoids using a run-on?

A.
The car had to swerve suddenly when they saw another car going through a red light; thankfully there was no accident.

B.
The car had to swerve suddenly they saw another car going through a red light, thankfully there was no accident.

C.
The car had to swerve suddenly when they saw another car, going through a red light thankfully there was no accident.

D.
The car had to swerve suddenly, when they saw another car going through a red light, thankfully there was no accident.

Answers

Answer: It's A

Explanation: the ; it put at the right spot between sentances. with out it, it would have been a run-on or two consecutive sentances.

Other Questions
Please help 4 questions for 10 points!!!------------------------------------------------------------1) Which expression is equivalent to 4(23)?4(20+3)4(2+3)4(2+13)4(20+30)..................................................................................................2. Which expressions are equivalent to 4(42)?Select each correct answer.4(20+22)4(40+2)4(4+20)4(4+2).......................................................................................................3.Which expression shows how 645 can be rewritten using the distributive property?640+6206+205640+6564+65...............................................................................4.Tori uses the greatest common factor and the distributive property to rewrite this sum:24 + 84What expression does Tori write?2(24+42)12(2+7)24(1+4)4(6+21).....................................................................my last one got deleted.... paid rent of Rs.25000 by cheque. make journal entry Use a number line to order the numbers from least to greatest. HELLLPPPP!!!!! write the code for RNA from this DNA STRAND :AAAAAATTTTTTCCCGGGGTTTATATATC RIP grandsonhow does earths crust change earths surface [2.1 + (9.2 x 3.3)] x 0.8 PLEASE HELPPFill in the blanks in the following sentences with the logical word(s). Pay attention to the pronunciation.Spell out the following numbers in french: 1. 200:2. 256:3. 987:4. 875:5. 435:Based on the context, fill in the blanks in the following sentences with either the logical word or the appropriate forms of voir or croire. Say the whole sentence aloud.6. Est-ce que tu crois________Paul va aller au cinma ce soir?7. Elles_________les pommes sur la table.8.________vous aux fantmes?Oui! Vous_________ce fantme, l! Mais non, je ne le___________pas! i need help lol i forgot how to do this y32c-4-3 -2 -1-1+1 2 3 4-2+-3+-4+41What is the slope of the line? Since she tried blueberry ice cream Black Canary hasrefused to eat any other flavor. Explain why the Hitler youth had only mixed success among the young German people. You may use the following in your answer comradeship (friendship), compulsory membership. hi...need help....thank you.. A restaurant customer left $1.35 as a tip...Plz help me Which number is a reasonable estimate for 637x35? Square ABCD has diagonals AC and BD . What is mABDA180B90C45D360 complete the addition equation that represents the associative property DIRECTIONS: Use this information to answer Parts A, B, and C.A traffic cone has a diameter of 10 inches and a height of 27 inches.Part AFind the volume of the cone. Need answers for #3 please hep Carlitas body is made up of many cells. What is one thing all her cells have in common? Mt.Rainer in Washington,has a higher elevation than Mt.Shasta.The difference between their elevation is 248 feet.What is the elevation of Mt.Rainer? Write an equation and solve . (Plz answer quick)