The two statements which are correct analogies are:
The exhaust system of the car is the excretory system that removes waste. The engine of the car is the digestive system that circulates nutrients to the rest of the body.What is an Analogy?This is referred to as a comparison of two otherwise unlike things based on resemblance of a particular aspect.
Excretory system which consists of organs which remove metabolic wastes and toxins from the body.
In the case of a car, the exhaust system of the car is the excretory system that removes wastes such as carbon emissions, smoke etc. The engine of the car is the digestive system that circulates nutrients which is in the form of fuel to the rest of the body.
Read more about Excretory system here https://brainly.com/question/28855201
#SPJ1
Polymers are made of small units called
the answer is monomers
Answer: Monomers
Explanation: Can I have brainliest?
Besides relative humidity, identify another weather variable of the air in the classroom
that may be determined by using both temperature readings on the hygrometer.
The hygrometer calculates the relative humidity in the air as a percentage.
How are relative humidity levels determined?
In meteorological science, hygrometers are devices that measure the humidity, or the amount of water vapour in the air. To measure humidity, hygrometers of many major types are employed.
What are the two thermometers and how are they different from one another?
An infrared thermometer's digital sensor or a mercury-in-glass thermometer's bulb are two examples of temperature sensors that vary in response to temperature, and a visible scale is an example of a means to translate this change into a numerical number.
Visit this link to read more about Humidity: brainly.com/question/18861819
#SPJ1
A wave has a frequency of 34 Hz and a wavelength of 0.14. What is the wave's speed?
The speed of the wave of frequency 34 Hz is 4.76 m/s.
What is speed?Speed is measured as the ratio of distance to the time in which the distance was covered.
To calculate the speed of the wave, we use the formula below.
Formula:
S = λf.............. Equation 1Where:
S = Speed of the waveλ = Wave length of the wavef = FrequencyFrom the question,
Given:
f = 34 Hzλ = 0.14 mSubstitute these values into equation 1
v = 34×0.14v = 4.76 m/sHence, the speed of the wave is 4.76 m/s.
Learn more about speed here: https://brainly.com/question/4931057
#SPJ1
which evolutionary innovation was most significant in helping tetrapods move to dry terrestrial environments?
The amniotic egg is an evolutionary innovation which was most significant in helping tetrapods move to dry terrestrial environments
An egg with extra-embryonic membranes and a shell is referred to as an amniotic egg. In contrast to more primitive egg forms, the amniotic egg is "air-breathing," which means it exchanges gases with the environment. Amniotic eggs were a crucial adaption for creatures that lived on land, including several mammals, birds, and reptiles. Amniotes are animals that lay amniotic eggs.
A group of tetrapod vertebrates known as amniotes includes mammals, birds, and reptiles. An egg with an amnion, an adaption to lay eggs on land or keep the fertilised egg inside the mother, is what distinguishes amniotes from other species.
Whether implanted as eggs or carried by the female, amniotic embryos are shielded and helped by a number of thick membranes. These membranes cover the amniotic sac, which envelops the developing foetus in eutherian mammals (including humans). The absence of a larval stage and these embryonic membranes set amniotes apart from tetrapod amphibians.
To learn more about amniotic egg refer here:
https://brainly.com/question/14791069
#SPJ4
the movement of a drug through the tissues and cells of the body, including the processes of absorption, distribution, and localization in tissues; biotransformation, and excretion by mechanical or chemical means is called
Pharmacokinetics is the study of how drugs are absorption, distributed, transformed biologically, and excreted by the body.
Pharmacodynamics is the study of a drug's biochemical and physiological effects and how it works. The transport of a medication into the bloodstream is known as absorption. There are many variables that affect how quickly and how much a medicine is absorbed, including: administration route a drug's chemical makeup and formulation. Drug metabolism is the term used to explain how pharmaceutical drugs are biotransformed in the body to facilitate easier elimination. Subcellular delivery refers to the process of delivering a drug's active form to the cell's target region of action.
Learn more about absorption
https://brainly.com/question/28196664
#SPJ4
The Energy Pyramid is used to illustrate how energy gets transferred from one organism to another. Explain what organisms types are involved and how some energy gets lost.
Answer:
The Energy Pyramid is a visual representation of how energy is transferred from one organism to another in an ecosystem. The pyramid shows the relationship between different levels of the food chain, with the primary producers at the bottom, followed by the primary consumers, the secondary consumers, and so on.
At the base of the pyramid are the primary producers, which are typically plants or algae that convert sunlight into energy through photosynthesis. These primary producers are then eaten by primary consumers, which are herbivores that feed on the plants. In turn, the primary consumers are eaten by secondary consumers, which are carnivores that feed on the primary consumers. This process continues up the pyramid, with each level representing a trophic level.
As energy is transferred from one organism to another, some of the energy is lost through processes such as respiration, excretion, and the production of waste. This is why the pyramid narrows at each higher level, as there is less energy available to support the organisms at that level. The loss of energy at each level means that there are fewer organisms at higher levels of the pyramid.
if you are considered prehypertensive, what are some steps you can take to lower your blood pressure?
Answer:
67%
Explanation:
simple diffusion (sd), facilitated diffusion (fd) and active transport (at) across a membrane. which process requires a concentration gradient of the transported molecule
Option D, active transport (AT) processes can establish a concentration gradient across a membrane.
Active transport involves the movement of chemicals from a low-concentration location to a high-concentration area in opposition to the concentration gradient. Being "active" means that this process uses energy (usually in the form of ATP). Active transport is the type of transport that can move sodium across the plasma membrane in a concentration gradient. Protein pumps move molecules during active transport in opposition to concentration gradients from low to high concentrations. Metal ions are among the substances that are moved by main active transport through the cell membrane.
The complete question is :
consider simple diffusion (SD), facilitated diffusion (FD), and active transport (AT) across a membrane. Which processes can establish a concentration gradient?
a. FD only
b. SD only
c. FD and AT
d. AT only
e. SD and FD
learn more about active transport here:
https://brainly.com/question/18777909
#SPJ4
what class does this animal belong to? group of answer choices cephalapoda polyplacophora gastropoda bivalvia
Option C. Gastropoda, Gastropoda fall under the taxonomic category of invertebrates and are a part of the kingdom Animalia.
The term "invertebrate" refers to a class of organisms, particularly the vertebral column, also known as the spinal cord, that lack a skeletal skeleton. The gastropods are a significant subclass of this phylum that includes numerous species of snails and slugs as examples of common gastropods. One of the rare classes of animals that can thrive in each of the three habitat types—terrestrial area, marine water system, and freshwater ecosystem—is the gastropoda.
To learn more about invertebrate please click on below link
https://brainly.com/question/13285943
#SPJ4
The inner membrane of the mitochondria provides a large for breaking the bonds in sugar molecules.
Answer:
Explanation:
It maintains the proton gradient that drives oxidative phosphorylation.
The inner membrane of the mitochondria does provide a large surface area for breaking down the bonds in sugar molecules.
What is mitochondria?Mitochondria are organelles found in the cells of eukaryotic organisms, including animals, plants, and fungi. They are often referred to as the "powerhouses" of the cell because they are responsible for producing the majority of the cell's energy supply. Mitochondria have a double membrane structure, with an outer membrane and an inner membrane. The inner membrane is folded into small, finger-like projections called cristae, which increases the surface area of the membrane.
Mitochondria are the site of cellular respiration, a process by which energy is extracted from organic molecules, such as glucose, to produce the energy-rich molecule adenosine triphosphate (ATP). The energy released from this process is used by the cell to perform various functions, such as muscle contraction and protein synthesis.
Mitochondria also have their own DNA and reproduce independently of the cell. They are thought to have originated as a symbiotic relationship between ancient cells and bacteria. They have their own genetic material, which suggests that they have a separate evolutionary history from the rest of the cell.
Learn more about mitochondria, here:
https://brainly.com/question/10688306
#SPJ2
micro 12 which of the following antibiotics is recommended for use against gram-negative bacteria? a) polyenes b) bacitracin c) cephalosporin d) penicillin e) polymyxin
Polymyxin antibiotics is recommended for use against gram-negative bacteria. So, correct option is (e)
treatment Gram-negative infections
Gram-negative infections can be successfully treated with the help of fourth-generation cephalosporins like cefepime, extended-spectrum -lactamase inhibitor penicillin like piperacillin/tazobactam and ticarcillin/clavulanate, and most importantly, carbapenems like imipenem/cystatin, meropenem, and ertapenem.
Polymyxins interact with the lipopolysaccharide (LPS) of Gram-negative bacteria's outer membrane before being taken up through the "self-promoted uptake" pathway. The calcium and magnesium bridges that stabilize the LPS are replaced when the polycationic peptide ring attaches to the outer membrane.
To learn more about gram-negative, visit to
https://brainly.com/question/1194544
#SPJ4
How many water molecules would be needed to break apart a carbohydrate made of 27 glucose monomers? Explain
Carbohydrates are made up of monosaccharides, which are simple sugars such as glucose. When two or more monosaccharides are joined together, they form a disaccharide or a polysaccharide. Polysaccharides are long chains of monosaccharides that are joined together by glycosidic bonds.
In order to break apart a carbohydrate made of 27 glucose monomers, you would need to hydrolyze the glycosidic bonds that hold the monomers together. Hydrolysis is the process of breaking a chemical bond by adding water molecules. For each glycosidic bond that you want to break, you would need to add one water molecule.
Since a carbohydrate made of 27 glucose monomers would have 26 glycosidic bonds (one less than the number of monomers), you would need to add 26 water molecules to break it apart. This is because each water molecule would be used to hydrolyze one of the 26 glycosidic bonds in the carbohydrate.
It's worth noting that the number of water molecules needed to break apart a carbohydrate would depend on the length of the carbohydrate and the type of glycosidic bonds it contains. For example, a carbohydrate with more monomers or with different types of glycosidic bonds might require more water molecules to be hydrolyzed.
learn more from here:
https://brainly.com/question/1403345
which do you think would be able to move more easily, and why? the earthworm, because it uses two sets of muscles to help it move through the watery solution the nematode, because its whiplike motion will easily propel it through the watery solution the earthworm, because it can contract and expand its muscles to burrow down through the watery solution the nematode, because it can move its paddle-like appendages on its segments to help it move through the watery solution
Earthworms exude a slimy fluid to aid in mobility, which makes it simpler for them to travel on a rough surface than it is for them to do so on a smooth one.
The nematode's whip-like action will readily drive it through the watery solution surface the earthworm can contract and extend its muscles to burrow through the watery solution surface the nematode can move its paddle-like appendages on its segments to help earthworm to travel through the watery solution surface since it has two sets of muscles to assist it move through the watery solution. Longitudinal muscles traverse the length of the body, whereas circular muscles loop around each section.
The complete question is:
which do you think earthworm would be able to move more easily, and why?
learn more about earthworm here:
https://brainly.com/question/13938105
#SPJ4
When there is no pattern to a
population's growth, it is known as
A. cyclical
C. irruptive
B. declining
D. irregular
When there is no pattern to a population's growth, it is known as irregular and is therefore denoted as option D.
What is Population?This is referred to as the total number of organisms in an area over a given period of time and population growth could either be increasing, decreasing or being stable.
There are four types of population growth and they include the following below:
StableIrruptiveCyclicIrregular.A stable population growth occurs when there is a constant age-specific fertility and mortality rates over a long period of time. On the other hand, an irregular population growth is the one in which there is no pattern and it results in a chaotic behavior in population size which is therefore the reason why option D was chosen as the correct choice.
Read more about Population growth here https://brainly.com/question/1437549
#SPJ1
Net primary productivity is the primary productivity of an ecosystem, after subtracting energy lost in
A. dead plant tissues.
B. inedible plant tissues.
C. respiration by primary producers.
D. respiration by primary consumers.
E. inefficiencies of photosynthesis.
Net primary productivity is the primary productivity of an ecosystem, after subtracting energy lost in C. respiration by primary producers.
What is the primary productivity of an ecosystem?In ecology and biology, the primary productivity of an ecosystem can be defined as a process in which the photosynthesis rate of all plants or algae is measured having into account their respiratory rate, which is very useful to determine the net primary productivity of such ecosystem in certain conditions.
The primary productivity of an ecosystem also allows for determining the net biomass that may be generated by the producer in certain conditions of the ecosystem.
Therefore, with this data, we can see that the primary productivity of an ecosystem can be defined as the amount of energy produced by the photosynthesis of autotrophs in the ecosystem having into account their respiratory rate.
Learn more about the primary productivity of an ecosystem here:
https://brainly.com/question/16129377
#SPJ1
Drag the terms to the correct boxes to complete this infographic on the general parts of the eukaryotic cell. Cell Wall External Chromosomes Internal Mitochondria Cytoskeleton Glycocalyx Cilia Ribosomes Boundary EUKARYOTIC CELL Cytoplo membrane Append Nu Homebound Olle Endoplasmi reculum Coleratu Flagella Nuclear envelope Muide Mikrotubules Intermediate laments Actin laments chlo
A nucleus and other membrane-bound organelles are found in the cells of eukaryotes, which are creatures.
What are eukaryotic cells?A nucleus and other membrane-bound organelles are found in the cells of eukaryotes, which are creatures. All mammals, plants, fungi, protists, and the majority of algae are eukaryotic creatures, as are many other types of life. Single cells or many cells can make up eukaryotes.
Eukaryotic cells are comprised of 3 major compartments. There are two different kinds of glycocalyx and appendages in the exterior compartment.The boundary can consist of a cell membrane and possibly a cell wall as well. The internal compartment is comprised of the cytoplasm, the nucleus, cytoskeletal components, and other organelles, such as mitochondria and ribosomes.To learn more about Eukaryotic cells refer to:
https://brainly.com/question/495097
#SPJ4
many cancer cells shut down expression of the bax or bak gene. how will the cancer cell benefit from this cellular change?
The cancer cell will profit from this biological alteration since the mitochondria will be less likely to produce cytochrome C, preventing apoptosis.
Contrary to popular belief, healthy mitochondria are necessary for the growth of cancer cells. Cancer cells frequently harbor mutations in the mitochondrial genes, but these abnormalities do not deactivate the mitochondrial energy metabolism; rather, they change the cytochrome C condition of the mitochondria's bioenergetic and biosynthetic processes. In mammalian cells, mitochondria are essential for initiating apoptosis. Members of the cytochrome C control how proteins are released from the area between the inner and outer membranes of the mitochondria.
learn more about cancer cell here:
https://brainly.com/question/373177
#SPJ4
Biologists are analyzing soil to check for the number of worms and grubs in a wildlife preserve. Let the random variable w represent the number of worms found in 1 square foot of soil, and let the random variable g represent the number of grubs found in 1 square foot of soil. The following tables show the probability distributions developed by the biologists for w and g.
Note that using the discrete distributions, it is found that the mean and standard deviation are given by: μ=5.28 and σ=1.67 (Option C)
What is Discrete Distribution?A discrete distribution has data that can only take on particular values, such as integers. A continuous distribution is one in which data can have any value within a certain range (which may be infinite).
Not that:
The total of all outcomes multiplied by their relative probability yields the mean of a discrete distribution.The variance is calculated by multiplying the total of the differences squared between each event and the mean by their corresponding probabilities.The mean is the total of the means when two variables are joined, whereas the standard deviation is the square root of the sum of the variances.The computation is given as follows:
For Worms:
E[tex]_{w}[/tex] (X) = 0.05(0) + 0.06(1) + 0.18(2) + 0.35 (3) + 0.3(4) 0.05 (5) + 0.01 (6)
= 2.98
Var[tex]_{w}[/tex] (X) = 0.05 (0-2.98)² + 0.06 (1-2.98)² + 0.18(2-2.98)² + 0.35 (3-2.98)² + 0.3(4-2.98)² + 0.05 (5-2.98)² + 0.01 (6-2.98)²
= 1.4596
For Grubs:
E[tex]_{g}[/tex] (X) = 0.05(0) + 0.21(1) + 0.27(2) + 0.38(3) + 0.05(4) + 0.03(5) + 0.01 (6)
= 2.3
Var[tex]_{g}[/tex] (X) = 0.05 (0-2.3)² + 0.21(1-2.3)² + 0.27(2-2.3)² + 0.38(3 - 2.3)² + 0.05(4-2.3)² + 0.03(5-2.3)² + 0.01 (6-2.3)²
= 1.33
The sum, therefore, is given as:
E (X) = E[tex]_{w}[/tex] (X) + E[tex]_{g}[/tex] (X)
= 2.98 + 2.3
μ = 5.28
σ = √ (Var[tex]_{w}[/tex] + (Var[tex]_{g}[/tex] (X)
= √ (1.4596 + 1.33)
= √2.7896
= 1.67020956769
σ [tex]\approx[/tex] 1.67
Hence, it is correct to state that in the discrete distributions - mean and standard deviation are given by: μ=5.28 and σ=1.67 (Option C).
Learn more about Standard Deviation:
https://brainly.com/question/23907081
#SPJ1
Full Question:
Biologists are analyzing soil to check for the number of worms and grubs in a wildlife preserve. Let the random variable W represent the number of worms found in 1 square foot of soil, and let the random variable G represent the number of grubs found in 1 square foot of soil. The following tables show the probability distributions developed by the biologists for W and G.
W 0 1 2 3 4 5 6
Probability 0.05 0.06 0.18 0.35 0.30 0.05 0.01
G 0 1 2 3 4 5 6
Probability 0.05 0.21 0.27 0.38 0.05 0.03 0.01
Assume that the distributions of worms and grubs are independent. What are the mean, μ, and standard deviation, σ, for the total number of worms and grubs in 1 square foot of soil?
A) μ=5 and σ=1.67
B) μ=5 and σ=2.36
C) μ=5.28 and σ=1.67
D) μ=5.28 and σ=2.36
E) μ=5.28 and σ=2.79
explain the difference between arguing that humans (or other species) are fitness maximizers vs. adaptation executers.
Specifically, sociobiologists believe that the main goal of humans is to increase reproductive success, to be "fitness maximizers."
However, evolutionary psychologists believe humans to be "adaptation executors" or "mechanism activators." They believe the main goal of human beings is to solve the problems of survival ...
Persons would pay to donate to sperm banks, which is FALSE since sperm banks do not reflect ancestral conditions. Fitness maximizers are people who intentionally aim to maximize fitness.
Executors of adaptations: once we comprehend adaptations, we can explain bxr
Evolved adaptations are preferred by evolutionary psychologists.
"Individual creatures should be viewed more as adaption executors than as fitness maximizers, according to this statement."
Learn more about " fitness maximizers vs. adaptation executers" to visit here;
https://brainly.com/question/1831916
#SPJ4
Complete Question :-
Explain the difference between arguing that humans (or other species) are fitness maximizers vs. adaptation executers. Which argument is favored by evolutionary psychologists, in contrast to sociobiologists?
notch is a receptor protein displayed on the surface of certain cells in developing fruit fly embryos. notch’s ligand is a membrane-bound protein called delta that is displayed on the surface of adjacent cells. when notch is activated by its ligand, the intracellular tail of the notch protein becomes separated from the rest of the protein. this allows the intracellular tail to move to the cell’s nucleus and alter the expression of specific genes.
Delta's role in regulating cell communication through the Notch signaling pathway is that Delta restricts cell communication to short distances within a developing embryo.
What is cell communication?Chemical signals are typically used by cells to communicate. These chemical signals, which are proteins or other molecules made by the sending cell and released into the extracellular space, are frequently secreted by the cell. They can then travel to nearby cells by floating there, much like messages in a bottle.
During the development of fruit fly embryos, the receptor protein notch is visible on the surface of some cells. The protein delta, which is membrane-bound and expressed on the surface of neighboring cells, is the ligand for the notch. The intracellular tail of the notch protein separates from the rest of the protein when notch is activated by its ligand. Consequently, the intracellular tail can move to the cell's nucleus and change the way some genes are expressed.
Learn more about cell on:
https://brainly.com/question/13123319
#SPJ1
long-term potentiation enhances the release of which neurotransmitter into the synaptic cleft, resulting in enhanced learning?
Long-term potentiation (LTP) typically happens at synapses where the sending neuron releases the neurotransmitter glutamate into the synaptic cleft—the area between the sending and receiving neurons.
Over the past 40 years, much research on long-term potentiation (LTP) of excitatory synaptic transmission in the hippocampus has been conducted. However, the precise location and manner of LTP expression continue to be debatable matters.
Both pre- and postsynaptic contributions to LTP expression have received a lot of support. Although it is generally accepted that postsynaptic expression mechanisms play a major role in the production of LTP, the evidence for this assertion is susceptible to other explanations.
We quickly discuss some significant contributions to the "locus" controversy and discuss evidence in favor of presynaptic processes playing a major role.
Learn more about " Long-term potentiation (LTP) " to visit here;
https://brainly.com/question/28198068
#SPJ4
I need help please
Which organs work together in the respiratory system of a hamster to help it breathe? OA. Spinal cord and nerves B. Lungs and windpipe C. Gills and gill filaments OD. Lymph nodes and lymph
Answer:
B. Lungs and windpipe
Hope helps:")
methylation regulates transcription a. via the addition of a methyl group to cytosine bases of dna. b. via the addition of a methyl group to cytosine residues on rna polymerase ii. c. via the addition of a methyl group to cysteine residues on rna polymerase ii. d. via the addition of a methyl group to cysteine bases of dna.
Option A, methylation regulates transcription via the addition of a methyl group to cytosine bases of DNA.
DNA methylation controls gene expression by attracting proteins implicated in gene repression or by preventing transcription factor(s) from binding to DNA. De novo DNA methylation and demethylation both play active roles in the dynamic process that alters the pattern of DNA methylation in the genome during development. DNA methylation, in general, inhibits transcription, and loss of methylation is linked to gene activation. In rare circumstances, DNA methylation might directly obstruct the binding of transcription factors.
The complete question is:
Methylation regulates transcription
a. via the addition of a methyl group to cytosine bases of DNA
b. via the addition of a methyl group to cysteine residues on RNA polymerase II
c. via the addition of a methyl group to cysteine basses of DNA
d. via the addition of a methyl group to cytosine resides on RNA polymerase II
e. by interfering with the chromatin remodeling process
learn more about methylation here:
https://brainly.com/question/7453747
#SPJ4
match each term to its defention
Answer: Can you add the image?
Explanation: There is nothing here.
original DNA: TACTTTAATCCCAAATTTACT
DNA: TACTTTAATCCCAAGTTTACT
mRNA: ?
amino acid: ?
what type of mutation is this: ?
Answer:
substitution mutation
Explanation:
The original DNA sequence is: TACTTTAATCCCAAATTTACT
The mutated DNA sequence is: TACTTTAATCCCAAGTTTACT
The mRNA transcribed from the mutated DNA sequence is: AUGAAAUUAGGGUUAAUUAGA
The amino acid sequence encoded by the mRNA is: Met-Lys-Ser-Trp-Lys-Lys-Ser
This is an example of a substitution mutation, in which a single nucleotide in the DNA sequence is changed. In this case, the original DNA sequence contains the nucleotide A at position 13, while the mutated sequence contains the nucleotide G at the same position. This change causes a different mRNA sequence to be transcribed and a different amino acid to be encoded. Substitution mutations can have a variety of effects on gene function, depending on the location and nature of the mutation. Some substitution mutations may have no effect, while others may cause the protein encoded by the gene to function improperly or not at all.
modern humans have: a. large browridges, large nasal sinuses, and a large masticatory complex. b. a high vertical forehead, a round and tall skull, and small browridges. c. a small face, small teeth, and a projecting chin. d. both b. and c.
Modern humans have traits a high vertical forehead, a round and tall skull, and small browridges
The lighter skeletons of modern humans can be used to identify them anatomically from ancient humans. Modern humans have extraordinarily large brains, which vary in size from population to population and between males and females. The average size of these brains is approximately 1300 cubic centimetres.
Many of the physical and behavioural traits that modern humans have evolved share some similarities with other early human species, though not to the same extent. Modern humans were able to connect with their environment and one another in novel and unusual ways thanks to their complex minds. Our predecessors were better able to survive as the environment got more unpredictable thanks to larger brains.
To learn more about modern humans refer here:
https://brainly.com/question/28039960
#SPJ4
(b) Many insects use litter on the soil surface as a habitat and for nutrients. Discuss how the
invasion of earthworms is likely to change the forest food web.
The invasion of earthworms is likely to change the forest food web by improving the nutrient level of the soil but decreasing the amount of litter on the soil surface, thus, decreasing the number of insects on the forest floor.
What is a food web?A food web is an interconnection of related food chains showing how organisms that are present in the food chain depend on each other for the provision of food.
The invasion of earthworms is likely to change the forest food web. Earthworms present in soil increase soil fertility by burrowing, feeding on leaf litter, and mixing soil
These activities of earthworms affect the soil properties causing changes in soil layers, vegetation, and soil organisms.
For example, the insects that use litter on the soil surface as a habitat and for nutrients would not have enough litter to make their home.
Learn more about a food web at: https://brainly.com/question/2179
#SPJ1
What has the greatest influence on windspeed
The primary factor affecting wind speed is the pressure gradient between high and low pressure locations.
What affects the wind's velocity?
The difference in pressure between high- and low-pressure zones is known as a pressure gradient.
The pressure gradient and wind speed are intimately correlated, so as the pressure gradient (i.e., change in pressure) grows, the wind speed at that place also increases.
What influences wind speed the most?
Because the sun heats the Earth differently in different regions, creating pressure differences, wind is a result of a horizontal variation in air pressure, therefore the sun is the primary source of most winds.
To learn more about Primary Sources
Visit:
https://brainly.com/question/29771183
#SPJ1
A scientist studying a species of algae, Gracilaria domingensis, discovered that its color is controlled by a single gene with two alleles. The individuals with a red or green phenotype are homozygous for the red or green alleles and the individuals with a brown phenotype are heterozygous. The scientist crosses two brown individuals. What percent of the offspring from this cross is predicted to be brown?
When the individuals of Gracilaria domingensis (red algae) with a brown phenotype are crossed, then there would be a 50% chance of having brown offspring from this cross.
What type of algae is Gracilaria domingensis?Gracilaria domingensis belongs to Rhodophyta and it is a macroalgae. It comes under the genus Gracilariales and has more than 300 species. It is of great economic importance. It is also used as food by humans and shellfish. This alga has a cylindrical or blade-shaped thallus with lateral branches. Gracilariales is the third-largest genus in the group of red algae.
Gracilaria species is also a source for the extraction of a complex polysaccharide which is agar. Agar is used widely in laboratories for routine cultivation and in electrophoretic techniques. It is also used in food industries, in the making of jellies, caramel, and frozen food items.
To learn more about red algae, refer to the link:
https://brainly.com/question/1908380
#SPJ2
at the end of which week of the ovarian cycle should implantation occur (assuming there is an embryo)?
Answer:
first week
Explanation:
it takes 2 to 3 days tk get embryo
