In a cladogram (a type of phylogenetic tree), clades are groups of related organisms. In the past, phylogenetic lists built clades using the idea of parsimony, that the pattern that uses the fewest evolutionary changes is the most likely to be correct. Today, with the use of computers and DNA sequences, the explanation that is thought to be the best is ___________ .

Answers

Answer 1

Answer:

one with the fewest number of genetic differences in the nucleotide sequence.

Explanation:

A cladogram is a diagram capable of showing the relationships among different species and/or group of organisms. In a cladogram, the root indicates the common ancestor, while internal nodes represent the common ancestors of each group. In consequence, this diagram can be used to establish evolutionary relationships in which the start branch points represent common ancestors shared by the organisms found in the 'branches'. Nonetheless, the length of the branches in the cladogram does not represent evolutionary distances among groups. In recent years, cladograms based on DNA sequencing data have been combined with morphological data to establish evolutionary relationships among species.


Related Questions

En la raza de ovejas Rommey Marsh, un gen conocido como gris letal, provoca que el feto gris GG, muera antes de las 15 semanas de gestación; El Genotipo heterocigótico Gg produce lana gris y el genotipo homocigótico gg produce lana negra. Si se cruzan individuos heterocigóticos. Cuáles serán las proporciones fenotípicas esperadas en la progenie viva? *

Answers

Answer

1:2:1

Please  check the file,due to technical reasons there was issues  with submission

Explanation:

Which structure is located between the trachea and a bronchiole? A. epiglottis B. pharynx C. alveolus D. bronchus

Answers

the correct answer is the bronchus

The hypothalamic hormone that triggers the secretion of FSH and LH from the anterior pituitary is

Answers

Answer:

Hypothalamic-Pituitary-Gonadal Axis

GnRH produced by the hypothalamus stimulates the production of both LH and FSH. FSH functions by stimulating ovarian follicular development in females and regulating spermatogenesis in males. LH induces ovulation and corpus luteum formation in the ovaries.

plz give brainlist

hope this helped

Explain how scientific knowledge develops through making observations about the natural world.

Answers

Answer:

Scientific knowledge develops through making observations about the natural world. An observation may generate a scientific question, which may lead to a hypothesis. The hypothesis can be tested through experimentation. The results of experimentation lead to changes in scientific knowledge.

Explanation:

Explain how scientific knowledge develops through making observations about the natural world.  my answers are never wrong trust me

PLEASE ANSWER ASAP!!!!!!!! ITS DUE IN 5 MINUTES.

1.) How do organisms benefit from Mitosis? Write a paragraph using at least five sentences.


Answers

Answer:

Organisms benefit from mitosis because mitosis helps regenerate cells. This helps them recover from injuries and more.

Explanation:

1. ____Bacteria are the only microorganisms used in the fermentation process 2. ____Fermentation can be used only to make dairy products 3. ____Starter cultures are used to initiate the process of fermentation in modern day food processing 4. ____Fermentation occurs when undesirable metabolic reactions allow for the growth of pathogens or the presence of unwanted microorganisms in food

Answers

Please sort the following statements as being true or false regarding fermentation and its role in food production. Please recall the role that microorganisms can play in the production of foods.

Answer:

1.  False statement

2.  False statement

3.  True statement

4.  False statement

Explanation:

1. Yeast is a microorganism which is also used in fermentation process.

2. Fermentation can however be used for various reasons, including: development of flavours, preservation and enrichment of foods, reduction of food cooking time etc.

3. Starter culture is considered to be a form of microbiological process which is used to initiate a process of fermentation.

4. Fermentation is considered to be a desired action of microorganisms

Statement that Bacteria are regarded as only microorganisms utilized in fermentation process is False

Statement that Fermentation is considered only when making dairy products is False.

Statement that Starter cultures can be utilized when initiating the fermentation process in food processing in this age is True.

Statement that Fermentation takes place when growth of pathogens or unwanted microorganisms in food are allowed by undesirable metabolic reactions is False.

Fermentation can be regarded as metabolic process whereby  organism converts a carbohydrate into alcohol or an acid.

This process is used in making dairy products, one of the organisms that can be used in fermentation is yeast.

Learn more at:

https://brainly.com/question/13050729?referrer=searchResults


1. If the temperature of the water increases from 5°C to 10°C, the goldfish in Population 1 would most likely

Answers

Answer:

hot water make it hard for fish to breathe

Explanation:

an increase in temperature of water will  reduced the dissolved oxygen in water and increase the metabolic rate of goldfish thus causing goldfish respiration rate

what mode of nutrition is house fly​

Answers

Answer:

Houseflies do not have chewing mouthparts like a cockroach or piercing-sucking mouthparts like a mosquito. They regurgitate digestive enzymes, soften and liquify the food material, and then they sop it up with their sponging mouthparts.

Hope this makes sense and helps

Please I need help with this

Answers

TAAGCCGATAAATGCTAACGGTA

Can someone describe these:
Menstrual Phase
Follicular Phase
and Luteal phase

Thanks!!!

Answers

Answer:

(menstrual phase) this is the phase where the unfertilized ovum and endometrium that was formed in readiness for implantation slough off or come out due to a sudden drop in progesterone levels

(follicular phase) this is where the graafian follicle in the ovary develops. from primary follicles due to secretion of follicle stimulating hormone by the pituitary gland and matures there after due LH hormone which will also stimulate the ovary to release the ovum

(luteal phase)this is the phase after the ovum has been released where the remains of the ruptured graafian follicle undergo reorganization to form a corpus luteum/yellow body which now produces progesterone which causes thickening of endometrium in readiness for implantation

hope this helps

Answer:

The menstrual cycle is the regular natural change that occurs in the female reproductive system that makes pregnancy possible. 2) The follicular phase is a phase of the estrous cycle during which follicles in the ovary nature from primary to a fully mature grafian follicle.It ends with ovulation.3) The luteal phase begins during the second half of a menstrual cycle normally lasting around 12 14 days after the ovulation and it is responsible for producing progesterone.

Beyond changes in relationships described above, explain what other characteristics of man changed after the Fall.

Answers

Answer:

The consequences of the fall was man and woman will die man turned to mortal and will turn back into dust. woman would bring children in pain. relationships between husband and wife would be difficult. The ground was cursed labor would be very hard. human was banned from the paradise and the garden. no longer would they enjoy the holiness and justice they had in paradise.

Explanation:

How are the proteins inside your body affected by the presence of water and other molecules?

Answers

Answer:

Our body is constitute of several essential molecules such as proteins, fat, carbohydrate, water, and other molecules.

Each molecule has some of the impact of other molecules in the body. Impact of water and other molecules on proteins inside the body are as follows:

Proteins have ligand-binding site and water provide stability to the ligand-binding site of proteins through its hydrogen bonds.Conformational flexibility and transitions of proteins are due to the presence of water molecules in it.Disbalance in the pH of body due to changing concentration of sodium-potassium ions can denature the protein. Enzymes present in the body can control the rate of formation of proteins in the body.

Shivering and vasoconstriction would be signaled to cause a: A. increase in pH. B. decrease in temperature. C. decrease in pH. D. increase in temperature.

Answers

Answer:D

Explanation: shivering occurs when someone is cold and vasoconstriction is when the blood vessels close to the skin and the veins closer to the skin surface constrict as a result of dat air doesn’t enter the body

Vasoconstriction is the narrowing of the blood vessels that hinders blood flow. Vasoconstriction and shivering will lead to an increase in the temperature through thermoregulation. Thus, option d is correct.

What is thermoregulation?

Thermoregulation is the maintenance and balancing of the temperature and heat in the body. They are regulated by many factors including shivering and vasoconstriction.

During the vasoconstriction, the blood vessels close to the skin surface close and the body shivers as a result of cold or decreased temperature. This signals the body to increase the temperature so that shivering can be stopped.

Therefore, vasoconstriction and shivering signal the body to increase the temperature.

Learn more about thermoregulation here:

https://brainly.com/question/7450241

#SPJ2

Which statements accurately describe the roles of water on earth

Answers

Answer:

C.

Explanation:

It carries cold water from the equator to the poles

Question What was the ratio of tall to short plants in the F2 generation of Mendel's experiments? A. 3:1 B. 2:1 O C. 1:1 D. 6:1 ​

Answers

Answer:

A

Explanation:

Answer: 3:1

Explanation:

i got it right on the test

Which statement is always true when describing sex-linked inheritance? It results in a dominant trait. The alleles are found on the X or Y chromosome. The resulting trait is influenced by multiple alleles. It is affected by alleles on at least three different chromosomes.

Answers

Answer:

the second one

Explanation:

there are only 2 sex linked chromosomes and that is X and Y

The true statement when describing sex-linked inheritance is ; ( B ) The alleles are found on the X and Y chromosome

The alleles responsible for reproductive inheritance from parents to offspring is contained in the X and Y chromosome of the reproductive gametes.

The female gametes contains double X chromosomes while the male reproductive gametes contains one X and one Y chromosomes. The alleles that are responsible for inheritance ( i.e. the sex of the offspring ) are contained in this chromosomes.

Hence we can conclude that The true statement when describing sex-linked inheritance is the alleles are found on the X and Y chromosome.

Learn more : https://brainly.com/question/24395447

Write TRUE or FALSE
(a)
A 'system' is the part of an organism that carries out a certain function.​

Answers

Answer:

TRUE

Explanation:

13. List 4 safety symbols that would be seen if you are working with a material that is biohazard, such as bacteria.

Answers

Answer:

1. Skull and crossbones

2. A triangle (commonly painted colour red or yellow) with an exclamation sign inside.

3. biohazard symbol

4. A radiation sign in the form of a triangle, having other little image descriptions inside.

Explanation:

Note that a biohazard material refers to dangerous substances of biological (living) nature that can pose a threat to humans. Thus, safety symbols try as much as to draw attention to the descriptions used.

For example, skull and crossbones and biohazard symbols are used to indicate that a material that is biohazard, such as bacteria could result in the death of a person.

Consider this animal cell. The organelles in an animal cell are labeled. Part E represents small dots on the nucleolus. What is the function of the small, dark organelles labeled E? They contain enzymes for the digestion of old cell parts. They regulate what enters and leaves the cell. They produce proteins for the cell. They store water and other materials.

Answers

The dark organelles labelled E is called the Ribosomes.    

The answer is Ribosomes

When human skin suffers a cut, the process of healing rapidly begins allowing for wound closure and healing within a few days. Keloids occur when skin around wounds continues to grow after the skin has healed. A disruption in the regulation of which cellular process is probably responsible for this condition

Answers

Options

A. Mitosis

B. Meiosis

C. Apoptosis

D. Phagocytosis

Answer:

A

Explanation:

Mitosis is a type of cell division which takes place in living  organism during growth and development.Therefore it is ensures  the regenerations of cells and tissues during healing.

Therefore the restoration of new cells to the skin following injuries is due to mitosis.Since this is a multiplication division(2n) in which the daughter cells are exactly like the parents' cells the new tissues of the skin by mitosis, look exactly like the previous one that was injured.

In cases where the mitotic growth control is lost, the scare tissues of the injured part overgrows with granulation tissues and this leads to Kaloids.

      Its is a mass of Collagen Type 1.(Collagen is an  fibrous proteins  which has largest proportion in mammals).

Keloids  is characterized with pink or red coloration and elevation of the area,excessive growth of the area, with irritating  patch skin

Consider this animal cell. The organelles in an animal cell are labeled. Part E represents small dots on the nucleolus. What is the function of the small, dark organelles labeled E? They contain enzymes for the digestion of old cell parts. They regulate what enters and leaves the cell. They produce proteins for the cell. They store water and other materials.

Answers

The dark organelles labelled E is called the Ribosomes.

Answer:

C

Explanation:

Edge 2020

a pupil performed an experiment in a school lab to show the action of a digestive enzyme on a food substance

a) Name and enzyme suitable for such an experiment
b) Name a food substance on which the enzyme that you have named will act
c) Describe any preparation of the food required before the experiment is performed. If no preparation is required state why?
d) give the temperature at which the enzyme-food mix should be maintained for the experiment to work
e) how much time is needed for digestion of food in this experiment?
f) describe a test to confirm that digestion has occurred ​

Answers

I prefer d as the correct answer!!!

Is there just one universal scientific method?

Answers

Answer:

There is no such unique standard method—scientific progress requires many methods—but students in introductory science courses are taught that `The Scientific Method' is a straightforward procedure, involving testing hypotheses derived from theories in order to test those theories.

Explanation:

SIOM CSserials
What has a greater influence on protein levels?
(1 point)
Protein degradation has a greater influence because outside factors like antibiotics can
cause it, and it is difficult to recover from.
O
Protein degradation has a greater influence because they are denatured faster than the cell
can produce them.
mRNA destroyer concentration has a greater influence because it is destroying mRNA before
proteins can even be produced.
mRNA destroyer concentration has a greater influence because mRNA is destroyed right
after the proteins are produced.

Answers

Answer:

mRNA destroyer concentration has a greater influence because it is destroying mRNA before  proteins can even be produced.

Explanation:

Proteins are synthesized from mRNA through the process of translation. mRNAs are first synthesized from a coding DNA template through the process of transcription. Hence, if mRNAs are destroyed, it means proteins will not be synthesized at all.

Protein not being synthesized at all means that mRNA destroyer concentration has a greater influence on protein levels than protein degradation. With protein degradation, not all the protein is degraded at once and some quantity of the protein can still be found, but with mRNA destroyer concentration, no protein can be found at all because it was not synthesized in the first place.

In brief state what happens when a) dry apricots are left transferred to sugar solution? b) a Red Blood Cell is kept in concentrated saline solution? c) the Plasma-membrane of a cell breaks down? d) rheo leaves are boiled in water first and then a drop of sugar syrup is put on it? e) golgi apparatus is removed from the cell?

Answers

Answer:

Explanation:

 (a) Dry apricots when placed in pure water swell due to osmosis and when in sugar water, they shrink again.

(b) When a Red Blood Cell is placed in concentrated saline solution exosmosis occurs and the RBCs shrink due to excess loss of water.

(c) Breaking of the plasma membrane leads to the scattering of the ceil organelles as it forms the basic supporting unit of the cell.

(d) When Rheo leaves are boiled in water first and then a drop of sugar syrup is put on it, osmosis does not occurs, due to the death of the cells of the leaf. This shows that selective permeability is property of living plasma membrane.

(e) Golgi complex helps in the package, storage and transfer of proteins synthesized by ribosomes. Thus, when ribosomes are removed the cell will not function properly

Name four breeds of cattle

Answers

Answer:

Black Angus, Red Angus, Holstein, Gelbvieh

Hope this helps!

True or False: Polar molecules do not have a difference in electrical charge.

Answers

Answer:

false

Explanation:

nonpolar molecule has no separation of charge, so no positive or negative poles are formed

Compared to its surroundings, the concentration of solutes is low inside a cell. So, the cell is in a
for its transport from the cell to its surroundings. This type of transport is called
solution. A particular solute in this cell uses energy
Reset
Next​

Answers

Answer:

Passive transport.

Explanation:

Osmosis occurs in the cell which is a type of passive transport. Passive transport refers to the transfer of solutes from one place to another without the expenditure or use of energy. Osmosis refers to the transfer of solutes from outside the cell into inside the cell through a semipermeable membrane which allow solutes which are small in size. This process occurs only when the concentration of solute is different inside and outside of the cell. while active transport is a type of transport which transfer solutes from one place to another with the use of energy in the form of ATP.

Which of the following is a testable hypothesis?
a. Roses are more beautiful than violets.
b. A plant needs at least five hours of sunlight per day to grow.
c. I've cream is delicious.
d. Humans will someday land on Mars.

Answers

Answer:

D. Humans will someday be on mars

nope, the only one you can test would be B, because the others are opinions or something in the future

Muscle cell are richer in lysosomes , as they require lot of energy. correct and rewrite the following statement.

Answers

Answer:

See below

Explanation:

The correct statement is:

=> Muscle cells are richer in mitochondria, as they required lots of energy.

Mitochondrion acts as power house of the cell providing the cell with the required energy.

Correct Statement:-

Muscle cells are richer in Mitochondria, as they require a lot of energy.

[tex] \large{ \underline{ \boxed{ \pink{ \rm{Explanation}}}}}[/tex]

Especially in Skeletal muscles, Mitochondria and glycogen granules are found in abundance. Our limbs that includes our arms and legs shows movement which needs energy. The food is oxidized and energy is released.

More to know:-Mitochondria is popularly known as Power house of the cell or ATP generation site.It is a double-membranous structure with outer membrane smooth and inner membrane surrounds the matrix.The inner membrane have cristae which increase surface area.The cristae bear Oxysomes or F0-F1 particles.Mitocondria is semi-autonomous, it have it's own DNA and ribosomes.

━━━━━━━━━━━━━━━━━━━━

Other Questions
By heating a 93% pure kclo3 sample, what percentage of its mass is reduced?2KCLO3---->2KCL+3O2 Leading up to the Battle for New York in 1776, Hamilton joined the ContinentalArmy hoping to see action in battle and perhaps a battle command. On whosestaff did he instead serve?Your answer All large radioactive atoms decay into smaller atoms by releasing alpha particles. Each alpha particle has 2 protons, 2 neutrons, and 0 electrons. The table below describes several neutral, low-mass atoms.A 4-column table with 4 rows, labeled Stable Isotopes of Low-Mass Elements. The first column labeled element name has entries hydrogen, helium, lithium, beryllium. The second column labeled symbol has entries H, H e, L i, B e. The third column labeled atomic number has entries 1, 2, 3, 4. The fourth column labeled number of neutrons has entries 0, 2, 4, 5.An alpha particle is also referred to as a nucleus of which isotope?lithium-7helium-4hydrogen-2helium-2 In 2008, golfer Annika Sornestam had a driving accuracy of 71%. That is, on par 4 and par 5 holes, her tee shot landed in the fairway 71% of the time. Explain how to use a spinner to simulate Sorenstams performance in a round of golf where she attempts 15 drives. (Hint: What type of chart is a spinner? What does each piece represent?) DEF Company is incorporating and coming to market with an initial public offering of common stock. The company has already filed their registration statement and the registration has become effective. The company sees that demand for securities is high, and decides to amend the total amount of common stock that will be offered. Would this amendment be allowable under the rules of the Uniform Securities Act Question 17 of 502 PointsWhich type of selection is the most likely to result in Speciation?A. Stabilizing selectionB. Directional selectionOC. Disruptive selectionD. Artificial selectionReset Selection Andy tells Ervin and Marina that everyone will lose their jobs if the company goes out of business, whether they have guild protection or not. Which influence tactic is Andy most likely utilizing? Which artist had the greatest influence over the ideas used by the FrenchRoyal Academy?O A. MichelangeloO B. RembrandtO C. PoussinO D. Rubens Please answer question now ****PLATO WORK PLZ HELP 30 POINTS**** Evaluate the end of the story when D introduces an element of dramatic irony. Why do you think the narration switches focus to the gun after the characters leave the ruined city? As the gun parts drive toward the broken gun, what mood is created for the reader? How is this ending an example of dramatic irony? What is the missing reason in the proof?StatementsReasons1. AB / CD; BC // DA 1. given2. Quadrilateral ABCD 2. definition of parallelogramis a3. AB CD; BC = DA 3. opposite sides of aparallelogram are >4. AC AC4. reflexive property5. AABC 2 ACDA 5. ?perpendicular bisector theoremPythagorean theoremHL theoremSSS congruence theorem When scientists are ready to publish the result of their experiments why is it important for them to include a description of the procedure they used Which is a minor theme in the land PLZ answer quick i will give brainliest if right no explanation needed Joe is responsible for reserving hotel rooms for a company trip. His company changes plans and increases how many people are going on the trip, so they need at least 50 total rooms. Joe had already reserved and paid for 161616 rooms, so he needs to reserve additional rooms. He can only reserve rooms in blocks, and each block contains 8 rooms and costs $900. Let B represent the number of additional blocks that Joe reserves. 1) Which inequality describes this scenario? Choose 1 answer: a: 16+8B50 b: 16+8B50 c: 16+B50 d: 16+B50 2) What is the least amount of additional money Joe can spend to get the rooms they need? 20 POINTS IF YOU ANSWER NOW!!!!!! Which factor is important to consider when buying a home air conditioning unit that is supposed to last several years? A.) Advertising Campaign B.) Capacity C.) Warranty plan D.) Design In the Mosher and associates Study from 2005, the vast majority of the participants Question 16 options: A experienced Gender Dysphoria B experienced prejudice because of sexual orientationC reported feelings of disapproval of others who were gay D reported only heterosexual behavior Why can gasses change volume?A. The forces holding the gas particles together arestronger than gravity.B. The gas particles have no mass, so they can change volume.C. Gravity has no effect on gas particles, so they can float away.O D. There are no forces holding the gas particles together. Anderson Corp. began the period with $200 of supplies. During the period, $500 of supplies were purchased. At the end of the period, there were $300 of supplies on hand. What will be the amount of the adjusting entry to record the amount of supplies used Guess the rule and write down the missing number: Solve without calculator log54 base 10