In brief state what happens when a) dry apricots are left transferred to sugar solution? b) a Red Blood Cell is kept in concentrated saline solution? c) the Plasma-membrane of a cell breaks down? d) rheo leaves are boiled in water first and then a drop of sugar syrup is put on it? e) golgi apparatus is removed from the cell?

Answers

Answer 1

Answer:

Explanation:

 (a) Dry apricots when placed in pure water swell due to osmosis and when in sugar water, they shrink again.

(b) When a Red Blood Cell is placed in concentrated saline solution exosmosis occurs and the RBCs shrink due to excess loss of water.

(c) Breaking of the plasma membrane leads to the scattering of the ceil organelles as it forms the basic supporting unit of the cell.

(d) When Rheo leaves are boiled in water first and then a drop of sugar syrup is put on it, osmosis does not occurs, due to the death of the cells of the leaf. This shows that selective permeability is property of living plasma membrane.

(e) Golgi complex helps in the package, storage and transfer of proteins synthesized by ribosomes. Thus, when ribosomes are removed the cell will not function properly


Related Questions

A gamete is best described as what?
A. The protective outer layer of an egg cell.
B. An enzyme in a sperm used to digest the egg cell's membrane.
C. A haploid cell produced for reproduction.
D. A diploid cell produced for reproduction.

Answers

Answer:

C. A haploid cell produced for reproduction.

Explanation:

The term "gamete" refers to reproductive cells such as sperm and ova. Sperm and ova are both haploid cells that unite to form diploid cells.

Multiple Choice: Please select the best answer and UICK
Which of the following items was Darwin able to use to study the structures of
extinct organisms?
A. Fossils
O B. Species
O C. Amino acids
O D. Adaptations

Answers

Answer:

The correct answer is fossils

Explanation:

Because fossils are used in studying extinct animals.

Hope this helps....

Have a nice day!!!!

here are times where you will be provided with BUD dates. When you do not have access to the BUD dates, you will have to determine that date yourself. What is the appropriate BUD date for a water containing oral formulation? Not later than 14 days Not later than 30 days

Answers

Answer:

Explanation: Not later than 14 days.

Beyond Use Date (BUD) is the date after which a compounded sterile preparation may not be stored or transported. This time is calculated from the date of compounding, and it is different from expiration date. This is because the BUDs are assigned with a different approach from those applied to assigning expiration dates to  manufactured drug products. Also, compounded preparations are intended for administration following short-term storage. So, the BUD is the date after which a compounded preparation shall not be  used. A reliable BUD is established to ensure that the preparation  has an accepted quality and purity at least  until the labeled BUD.

BUD is calculated by:

Type of container in which it is packagedHow long the medication will be takenType of drugHow fast is the drug degradatedStorage conditionsDosage of the medicationNature of the drug and its degradation mechanism Potential for microbial proliferation in the preparation

For Nonaqueous Formulation, the BUD is not later than 6 months or the time  remaining until the earliest expiration date of any API (Active pharmaceutical ingredient), whichever is earlier.  

For Water-Containing Oral Formulation, the BUD is not later than 14  days when it is stored at controlled cold temperatures.

For Dermal and Mucosal Liquid, Semisolid Formulations/Water-Containing Topical, the BUD is not later than 30 days.

A retired contract administrator who enjoyed gardening sought medical attention for what appeared to be a sinus infection. He received antimicrobials but the conditioned worsened and he was experiencing severe painful spasms in his jaw. He admitted to injuring himself with a gardening tool while wearing sandals in the yard but did not seek medical attention for the wound. The man is likely experiencing.
A. allergic rhinitis.
B. meningitis.
C. septic shock.
D. LPS-mediated inflammatory response.
E. intoxication caused by a focal C. tetani infection.

Answers

Answer:

The correct answer is E. intoxication caused by a focal C. tetani infection.

Explanation:

Clostridium tetani bacteria are found in the soil, in the feces and in the mouths of animals. The disease is acquired when wounds become infected by the bacteria. The spores become active and spread throughout the body producing a poison called tetanus toxin. This toxin blocks the nerve signals from the spinal cord to the muscles and can cause generalized severe muscle spasms (lockjaw) exacerbated by external stimuli or muscle spasms in areas adjacent to the wound.

Match each statement to the type of behavior it describes. Jenna published the results of her latest experiment for the public to see. Malcolm altered an experiment to be able reach his desired conclusion. Elena keeps complete records of all her experiment results. Neal shared the results of his field study even though they didn’t support his hypothesis.

Answers

Answer:

See the answer below

Explanation:

It may seem that the question is incomplete. The complete question reads:

Match each statement to the type of behavior it describes. Jenna published the results of her latest experiment for the public to see. Malcolm altered an experiment to be able reach his desired conclusion. Elena keeps complete records of all her experiment results. Neal shared the results of his field study even though they didn’t support his hypothesis. Put each description to the group it belongs to. 1.Responsible 2.Irresponsible.

To answer the question:

Responsible behavior

Jenna published the results of her latest experiment for the public to see.Elena keeps complete records of all her experiment results.Neal shared the results of his field study even though they didn't support his hypothesis.

Irresponsible behavior

Malcolm altered an experiment to be able to reach his desired conclusion

Responsible behaviors are those that support responsible scientific practices and do not jeopardize the objective nature of research. Every data during experiments must be well kept and after thorough analysis, results must be published fro the public to see irrespective of whether it agrees or disagrees with the original hypothesis.

Altering an experiment in order to achieve the desired result is grossly irresponsible, as this eliminates the objectivity that should be the main goal of every experiment. Bias must be eliminated from every scientific experiment.

The Amish populations in the United States began with relatively few individuals and have not recruited many newcomers to the population. Today, these Amish populations exhibit a much higher incidence of polydactyly (possessing extra digits) than other American populations. Which mechanism of evolution is likely responsible for this phenomenon

Answers

Answer: The founder effect

Explanation: The high incidence of polydactyl prevalent among the Amish population could be attributed to the a case of genetic drift called the founder effect. The founder effect occurs when a small population consisting of few people separate from a much large population, just like the Amish population separating from the larger American community. Due to the few composition or small size of the population, the genetic impact or influence on members of the population is usually higher than the effect on the larger population and leading to more rapid spread. The relatively small individuals which make up the Amish population compared to the larger American community is the reason why polydactyl hmis prevent within them and since theere are no newcomers, the trend will likely continue.

Which of the following will cause a decrease in the mass of an object? A. Increase in the gravitational pull B. Decrease in the gravitational pull C. Increase in the quantity of substance present in the object D. Decrease in the quantity of substance present in the object

Answers

Answer:

C

Explanation:

I have four brothers
"This is what type of
observation?

Answers

Quantatative data since it is physically counting

what type of environment would you most likely find fish species 1?

Answers

Answer:

Different species of fish are adapted for different habitats: rocky shores, coral reefs, kelp forests, rivers and streams, lakes and ponds, under sea ice, the deep sea, and other environments of fresh, salt, and brackish water. Some fish are pelagic: they live in the open ocean.

Explanation:

Interpreting an Expression Quick Chec How many factors does the expression (17 –r) have? O four O two one three​

Answers

Answer:

One

Explanation

Arborviral diseases: Group of answer choices Refer to arthropod-borne viral diseases Can produce central nervous system illness Are most often spread by mosquitoes May produce acute self-limited fevers

Answers

Answer:

All of the options are correct.

Arboviral diseases are arthropod borne, they can produce central nervous system illnesses, transmitted by mosquito bites and also produce acute self limiting fevers.

Explanation: Arboviruses are viruses that are harboured by arthropods which includes mosquitoes, they have the capacity to cause illnesses which are acute and self limiting(it has the ability to resolve on its own without treatment). It has also been found to cause illnesses to the central nervous system(the brain and the spinal cord).

Vanessa attempts to freeze liquid mercury. Which statements describe particle arrangement and motion that occur in mercury?

Answers

Answer:

Volume of mercury decreases due to close arrangement of particles.

Explanation:

When we freeze liquid mercury, its volume decreases and density increases from from 13.69 g/cm3 to 14.184 g/cm3 and form a solid mercury. The motion of particles stop when we freezes liquid mercury and the particles settles into a stable arrangement. If we cool the liquid mercury and the temperature reaches to -38.83 °C, then it converts from liquid into solid substance.

A cell biologist carefully measures the quantity of DNA in grasshopper cells growing in cell culture. Cells examined during the G1 phase of the cell cycle contained 200 units of DNA. What would be the amount of DNA in one of the grasshopper daughter cells right after cytokinesis?

Answers

Answer:

200 units

Explanation:

Cell cycle refers to the series of events that occurs throughout the division of a cell. Mitosis is the division used during cell growth. Mitosis consists of the Interphase stage and the Mitotic phase. The interphase stage is made up of the G1, S and G2 phases in that order. The genetic material (DNA) of the cell replicates during the Synthesis (S) phase.

Hence, this means that the DNA of grasshopper cells in the culture observed during the G1 phase will enter the S phase and replicate i.e. 200 units will form 400 units.

The cell go ahead to undergo nuclear division during the anaphase of the mitotic phase. Hence, each pole of the cell will contain 200units of DNA each. During Cytokinesis, the cytoplasm of the cell divides and the contents of the opposite poles becomes a new daughter cell. Each daughter cell will therefore contain 200 units of DNA each.

how many 2steps photosynthesis​

Answers

Explanation:

photosynthesis takes place in two stages the light depend reactions the light independent reaction or Calvin cycle

What adaptation allows the Artic fox to survive in its environment?

Answers

Answer: Arctic foxes have several adaptations that allow them to survive. Their round, compact bodies minimize surface area that is exposed to the cold air. Their muzzle, ears, and legs are short, which also conserves heat.

Explanation:

what mode of nutrition is house fly​

Answers

Answer:

Parastic

Explanation:

Explanation:

The mode of nutrition in house fly is known as SCRAPING

The intensification of ultraviolet rays has contributed to

Answers

Answer:

skin cancer,sunburn,accelerated skin aging etc.

Explanation:

The severity of the effect depends on wavelength,intensity and duration of exposure.

Answer:

increase in skin cancer. please give brainly!

Explanation:

a pupil performed an experiment in a school lab to show the action of a digestive enzyme on a food substance

a) Name and enzyme suitable for such an experiment
b) Name a food substance on which the enzyme that you have named will act
c) Describe any preparation of the food required before the experiment is performed. If no preparation is required state why?
d) give the temperature at which the enzyme-food mix should be maintained for the experiment to work
e) how much time is needed for digestion of food in this experiment?
f) describe a test to confirm that digestion has occurred ​

Answers

I prefer d as the correct answer!!!

Which best describes food when it reaches the stomach?

Answers

Explanation:

The polysaccharides have been broken down.

2. How are each of the following groups likely to feel about the reintroduction of wolves in Yellowstone National Park? (write 2-3 sentences for each)

a. Tourists who visit the park

b. Environmentalists (people who want to protect the nature of Yellowstone)

c. People who live near the park

Answers

Answer:

a) Good

b) Good

c) Bad

Explanation:

Tourists who visit the park feels good about the reintroduction of wolves in the park because it is a new animal they are seeing in the park. Environmentalists also feels good because this action is a step towards the protection of organisms present in the nature. People who live near the park does not feel good because wolf is a dangerous animal and if he escaped from the park, the lives of the people will be in danger.

Without the discovery of magnetic reversals recorded on the ocean floor, scientists

A. could not confirm the usefulness of sonar

B. could destroy the hypothasis of continental drift

C. could not provide a mechanism for moving continents

D. could explain how the seafloor was being destroyed

Answers

Answer:

C. could not provide a mechanism for moving continents

Explanation:

Magnetic reversals have the habit of causing geological displacements, since they are directly linked to the movements and distribution of tectonic plates on the planet, which are responsible for the movements of the continents. In this case,

if the discovery of magnetic reversals recorded on the ocean floor were not carried out, it would be impossible to establish its relationship with the movement of the tectonic plates, making it impossible to provide a mechanism for moving continents.

SIOM CSserials
What has a greater influence on protein levels?
(1 point)
Protein degradation has a greater influence because outside factors like antibiotics can
cause it, and it is difficult to recover from.
O
Protein degradation has a greater influence because they are denatured faster than the cell
can produce them.
mRNA destroyer concentration has a greater influence because it is destroying mRNA before
proteins can even be produced.
mRNA destroyer concentration has a greater influence because mRNA is destroyed right
after the proteins are produced.

Answers

Answer:

mRNA destroyer concentration has a greater influence because it is destroying mRNA before  proteins can even be produced.

Explanation:

Proteins are synthesized from mRNA through the process of translation. mRNAs are first synthesized from a coding DNA template through the process of transcription. Hence, if mRNAs are destroyed, it means proteins will not be synthesized at all.

Protein not being synthesized at all means that mRNA destroyer concentration has a greater influence on protein levels than protein degradation. With protein degradation, not all the protein is degraded at once and some quantity of the protein can still be found, but with mRNA destroyer concentration, no protein can be found at all because it was not synthesized in the first place.

Question 7 of 10
A certain plant has a color that can range from green to yellow. Some plants
are very green, and some are very yellow, but most are in between. What is
most likely true about this trait?
A. The color is a Mendelian trait.
B. There are several genes that control the color.
C. There are only two alleles for color.
D. Being yellow is a recessive trait.

Answers

Answer:

B. There are several genes that control the color.

Explanation:

According to the description of the trait in this question in which the plant exhibits a wide range of colors from green to yellow, it shows that the trait for color in such plant is controlled by two or more (several) genes. This kind of inheritance is called a POLYGENIC INHERITANCE.

Polygenic inheritance is a kind of non-mendelian inheritance (does not follow the principles of Mendel) in which phenotypic traits of an organism is controlled by several genes. Each gene possess two alleles, which equally contribute to the phenotypic expression of such trait. Traits controlled by polygenes do not conform to Mendel's laws of inheritance as the offsprings exhibit a range of traits from the mixture of parental traits as stated in the question.

In polygenic inheritance, most of the offsprings exhibit the intermediate phenotype (between green and yellow) with few extremes (green and yellow) due to a combination of the genes in the parental phenotypes. Hence, based on the description in the question, there are several genes that control the color trait in the plant.

Answer: B. There are several genes that control the color.

Explanation:

i got it right on the test

Galactosemia is an inherited genetic condition. Children with this condition cannot break down the sugar galactose, which is part of lactose. Based on the pedigree chart, is this condition a dominant or a recessive disorder? Explain your reasoning.

Answers

Answer:

Recessive.

Explanation:

Galactosemia is an autosomal recessive genetic disorder. Recessive genetic disorders occur when an individual inherits a non-working gene from each parent.

There is no chart attached, so the reasoning is just common scientific knowledge. Please attach the chart so I can properly answer the question!

Answer:

It is recessive. Both parents are heterozygous for the trait, but they do not exhibit the disease themselves. If it were a dominant gene, both parents would have the disease if they carried the gene for it.

Explanation:

This is the answer on edmentum! Thanks!

Which is most likely a source of air pollution? littering CFCs oil spill runoff

Answers

Answer: CFCs

Explanation: The other options aren’t as relevant to air pollution.

Answer:

cfcs

Explanation:

Write True or False for the following statements. Rewrite the false statements in correct forms.
a) A pitcher plant is a primary consumer.
b) A tick that survives on cattle can survive without plants on the Earth.
c) Oxygen is not a greenhouse gas.
d) Enhanced greenhouse effect helps maintain the average temperature of the Earth.
e) Earthworm is a decomposer. ​

Answers

Answer:

false statement is option A

Explanation:

correct form of option A is

A pitcher plant is a producer not consumer

Which of the following statements is true? Bacteria and protozoa are examples of unicellular organisms. Individual cells do not need to maintain homeostasis. Most multicellular organisms reproduce through mitosis. Two identical daughter cells are created from sexual reproduction.

Answers

Answer:

Bacteria and protozoa are examples of unicellular organisms.

Explanation:

Bacteria are prokaryotic organisms in which the genetic material is not enclosed in a membrane. Bacteria are one of the oldest groups on Earth. Bacteria may inhabit diverse environments such as the deep ocean, soils, acidic hot surfaces, radioactive materials, etc. On the other hand, protozoa (also known as protozoan) are unicellular, heterotrophic, eukaryotic microorganisms, whose genetic material is enclosed within a nucleus that has a membrane. This group was originally considered to be animals because they have animal-like features including, for example, motility and predation.

The statement "Bacteria and protozoa are examples of unicellular organisms" is true. Bacteria and protozoa are both single-celled organisms.

What are the false statements?

The statement "Individual cells do not need to maintain homeostasis" is false. Homeostasis is the ability of cells to regulate their internal environment to maintain a stable condition necessary for proper functioning.

The statement "Most multicellular organisms reproduce through mitosis" is false. Most multicellular organisms reproduce through a process called meiosis, which involves the formation of specialized cells called gametes.

The statement "Two identical daughter cells are created from sexual reproduction" is false. Sexual reproduction involves the fusion of two gametes, resulting in the formation of a genetically diverse offspring.

Read more about protozoa here:

https://brainly.com/question/30466234

#SPJ6

ANSWER ASAP PLEASEEEEEE!!!!!! ILL GIVE 100 POINTS!!

Answers

Answer:

A

Explanation:

Answer:

The answer is A both daughter cells will have identical genetic material to the parent cell.

Explanation:

plz give brainliest

In an ________ solution, red blood cells ________. Group of answer choices hyposmotic, lose water and shrivel isomotic, have a normal shape isosmotic, swell and may burst hyperosmotic, have a normal shape isosmotic, lose water and shrivel

Answers

[tex] \large{ \boxed{ \bf{ \color{skyblue}{The \: correct \: question:}}}}[/tex]

Q. In an ________ solution, red blood cells ________. Group of answer choices:

Hyposmotic, lose water and shrivel Isomotic, have a normal shape ✔️Isosmotic, swell and may burst Hyperosmotic, have a normal shape Isosmotic, lose water and shrivel

[tex] \large{ \boxed{ \bf{ \color{violet}{The \: correct \: answer:}}}}[/tex]

In an isosmotic solution, red blood cells have normal shape.

Option B

Explanation:-

Osmosis : The movement of the solvent or water molecules from a solution of their higher concentration to a solution of lower concentration through a semipermeable membrane.

❍ Depending upon the osmotic concentration, There are three types of solution and their result when cell is keot inside them:

Hyposmotic (Water enters, Swells up)Isosmotic(Equal flow, No change)Hyperosmotic(Water comes out, shrinkage)

━━━━━━━━━━━━━━━━━━━━

In part A, you analyzed genes that contribute to two diseases. (cystic fibrosis and muscular dystrophy) How can scientists use this information to develop new treatments for these diseases? Based on your findings, do you think that scientists will need to develop multiple treatments to control symptoms of these diseases? Explain your reasoning.

Answers

Answer:

By designing suitable gene therapies in order to restore target gene expression.

Explanation:

Cystic fibrosis and muscular dystrophy are inherited genetic disorders associated with serious health problems. Cystic fibrosis is caused by mutations in the gene that encodes for the cystic fibrosis transmembrane conductance regulator (CFTR) protein, and it is a condition associated with abnormal production of sticky mucus that leads to problems in the lungs and the digestive systems. On the other hand, muscular dystrophy is produced by mutations in genes localized on the X chromosome such as, for example, the gene 'dystrophin'. Gene therapy is an experimental approach used to compensate abnormal gene function by introducing exogenous genetic material and thus restore their altered protein products. Consequently, personalized gene therapies can be useful to treat inherited disorders such as cystic fibrosis and muscular dystrophy.

Other Questions
Last Sunday, the average temperature was 8\%8%8, percent higher than the average temperature two Sundays ago. The average temperature two Sundays ago was TTT degrees Celsius. Which of the following expressions could represent the average temperature last Sunday? Find an equation of the plane through the point(1, 5,-1) and perpendicular to the vector (1, 5, 1). Do this problem in the standard way. Solve for x: 2(10-2x) = 4(3x + 1). Write your answer as a fraction. can u help me ASAP. i need to know how to do it step by step the formula s= I dont know how to type that but I really need helppppp Pasteur's experiments proved that ________. Pasteur's experiments proved that ________. spontaneous generation can only occur if nutrient broth is left open to the environment cells cannot survive in swan-necked flasks preexisting cells present in the air can grow in sterilized nutrient broth sterilizing nutrient broth prevents spontaneous generation in order to grow, cells need to be supplied with oxygen please help !!!!! please note that two images are there................ i am urgently needs this question On a plane trip, baggage over 40 pounds ischarged at the rate per pound of 1% of the one-way fare. The charge for a bag weighing 52pounds on a trip where the one-way fare is $98is:HELP PLEASEE!! QUICK!! When the hydraulic conductivity Ks = 10 mm/hr; effective matrix potential Ns = 20 mm, and rainfall intensity I = 30 mm/hr , determine the amount of runoff generated when the runoff rate reaches 15 mm/hr?( 2.7 mm or 0.21 mm or 18 mm or 0.67 mm) PLS HELP ASAP Solve the inequality and enter your solution as an inequality in the box below 8>4-x>6 difference between photosynthesis and respiration In a survey of adults in a certain country conducted during a period of economic uncertainty, % thought that wages paid to workers in industry were too low. The margin of error was percentage points with % confidence. For parts (a) through (d) below, which represent a reasonable interpretation of the survey results? For those that are not reasonable, explain the flaw. how many are 2 raised to 2 ??? Choose the PCR primer pair that will amplify the breakpoint of a deletion of the segment of DNA between lines 1and 2. 5' TCGATTCCGGAAAGCTTAGTTTCCCGGGACGTATTGCCAACCTAGGTAAGCGCCGAATATCCATGGGCACC 3'3' AGCTAAGGCCTTTCGAATCAAAGGGCCCTGCATAACGGTTGGATCCATTCGCGGCATTATAGGTACCCGTGG 5'a. 5- AGCTAAGGCCTTTCGA and 5'-CCACGGGTACCTATAA b. 5'- TCGATTCCGGAAAGCT and 5'-ACGTCCCGGGAAACTA c. 5- TCGATTCCGGAAAGCT and 5'-CCACGGGTACCTATAA d. 5'- TCGATTCCGGAAAGCT and 5'- GGTGCCCATGGATATT e. 5' - GGTGCCCATGGATATT and 5' ACCTAGGTAAGCGCCG This rectangular patio is tiled using 50 cm by 50 cm square tiles. How many tiles are used? Imagine that you are the supply chain manager for the Magic Widget company and you need to measure your supply chain performance. The chart shows the financial variables that you will need to perform your task. Financial Variables Total Assets (in $ billions) 15.1 Cost of Goods Sold (in $ billions) 14.3 Inventory: Raw Material Inventory (in $ billions) 0.76 Work-in-progress Inventory (in $ billions) 0.12 Finished Goods Inventory (in $ billions) 0.82 Compute the percentage of assets committed to inventory and inventory turnover. What is the quotient of 35,423 15? The plateau phase of population growth is best described as: A. The population stops growing because they moved into the plateau environment at this stage. B. The population pauses in its growth after a natural disaster before growing again. C. The population moves onto a large, raised, flat area called a plateau for protection from predator. D. The population stops growing because the environment has reached its carrying capacity. The Coriolis effect Choose one: A. causes north-flowing currents in the northern hemisphere to curve to the west. B. causes the same direction of deflection in the northern and southern hemispheres. C. is a deflection of wind or water flowing over the Earth's surface. D. is a phenomenon created by the movement of ocean currents. Light passes through a single slit. If the width of the slit is reduced, what happens to the width of the central bright fringe