In ______ immunity the individual produces antibodies against particular pathogens while in ______ immunity the individual is given specific antibodies against a pathogen. Group of answer choices

Answers

Answer 1

Answer:

The correct answer is - active and passive.

Explanation:

Immunity is the capability of multicellular organism to protect itself from harmful molecules that are foreign to the body such as microorganism and antigens. Immunity can be active immunity or the passive immunity.

Active immunity takes place when one's own body produces antibodies to fight against a particular disease or antigen by immune system where as passive immunity occurs when an individual receives antibodies from outside and produced outside.

Thus, the correct answer is - active and passive.


Related Questions

If Sammi had more time or better resources, how could she improve her model to eliminate some of the weaknesses?

Answers

Answer:

She could use more materials to replicate the entire digestive system instead of the small intestine only. Maybe use some better material than cardboard to represent the villi lining. She could also use more capillaries to make it more realistic.

Explanation:

answer for plato activity, your welcome :)

Answer: She may utilize additional materials to duplicate the full digestive system instead of the small intestine only. Maybe use some better material than cardboard to represent the villi lining. She could also use more capillaries to make it more realistic.

Explanation:

Drag each label to the correct location. Classify the interactions as being direct or indirect competition. Two eagles fight over a salmon carcass. All the gray foxes in a habitat prey primarily on penguins. Two colonies of black ants clash over a wasp. Gray squirrels in an area rely on nuts for food.

Answers

Answer:

Two eagles fight over a salmon carcass- DIRECT

All the gray foxes in a habitat prey primarily on penguins- INDIRECT

Two colonies of black ants clash over a wasp- DIRECT

Gray squirrels in an area rely on nuts for food- INDIRECT

Explanation:

Living organisms of same or different species tend to interact with one another in their natural habitat. One of those interactions is competition, which occurs when living organisms share the same limited resources or occupy the same niche in their habitat.

However, competitive interaction between organisms can either be direct or indirect. Direct interaction is that which involves a physical interaction between the organisms i.e. a confrontation. A struggling for the limited resource is evident. For example, two eagles fighting over a salmon carcass and two colonies of black ants clashing over a wasp shows the form of physical confrontation for the limited resource between the organisms involved. Hence, they are examples of direct competition.

On the other hand, indirect competition involves the competition for a limited resource without a physical confrontation or struggle. Organisms make use of the limited resource until it becomes unavailable to competitors. For example, gray foxes in a habitat that prey primarily on penguins and gray squirrels in an area relying on nuts for food shows a competition for a scarce resource without any physical interaction between them. Hence, they are examples of indirect competition.

After school, Kai feels hungry and tired. He finds some sugar cookies in the cabinet and finishes the whole package.
Which statements best describe the role of glucagon and insulin in this scenario?
O Glucagon was secreted by his pancreas before he ate the cookies because his blood glucose was low. Insulin
was secreted after he ate the cookies because his blood glucose was high.
O Insulin was secreted by his pancreas before he ate the cookies because his blood glucose was low. Glucagon
was secreted after he ate the cookies because his blood glucose was high.
O Glucagon was secreted by his pancreas before he ate the cookies because his blood glucose was low. After he
ate, insulin from the cookies increased his blood sugar levels.
O Insulin was secreted by his pancreas before he ate the cookies because his blood glucose was low. After he ate,
glucagon from the cookies increased his blood sugar levels.

Answers

Answer: Option A) Glucagon was secreted by his pancreas before he ate the cookies because blood glucose was low. Insulin was secreted after he ate the cookies because his blood glucose was high.

Explanation:When Kai was hungry and his blood glucose level was decreasing, glucagon is the hormone which was secreted by the islets of pancreas to increase the blood sugar levels in his body. Glucagon forces the liver to release the stored glucose in it, which increases the blood glucose level in the body. When Kai ate the sugar cookies there was enough of blood glucose available for his body, also it exceeded the requirement and went high. Insulin was then secreted to control this excess glucose from the islets of pancreas. As it helps the body cells to absorb the glucose and lowers the amount of glucose in the blood. It makes the cell available with the glucose to produce energy and perform their activities.

In short, glucagon and insulin both are secreted by the same organ which is islets of pancreas. But they differ in their function, glucagon increases the blood glucose when the body needs it, whereas insulin helps to absorb the excessive glucose and stores that in the body. Both are the hormones which help in regulating the body glucose levels.

During  process of digestion which takes place in digestive tract statement which describes role of glucagon and insulin is glucagon was secreted by  pancreas before he ate the cookies because his blood glucose was low. Insulin was secreted after he ate cookies because his blood glucose was high.

What is digestive tract?

It consists of the gastrointestinal tract along with the accessory organs which are present in digestion process . It involves the breakdown of complex food into smaller components which can be easily assimilated and absorbed by the body.

The digestion process has 3 phases: cephalic phase , gastric phase and intestinal phase.Cephalic phase begins with secretion of gastric juices from gastric glands in response to sight and smell of food.It involves chewing and chemical breakdown of food by the action of digestive enzymes ,saliva in the mouth contain enzymes like lipase and amylase which are secreted by the salivary and serous glands present on the tongue.

Learn more about digestive tract,here:

https://brainly.com/question/28163067

#SPJ2

In the database, Academic Search Complete (Links to an external site.), search for the article "Brevetoxicosis: Red Tides and Marine Mammal Mortalities" by Flewelling et al. If you wanted to explore more of the scholarly conversation by taking advantage of "citation chaining" what links could you click on to help with this task

Answers

Answer: The link I would be clicking on with this task is Molecular detection of the brevetoxin-producing dinoflagellate Karenia brevis and closely related species using rRNA-targeted probes and a semiautomated sandwich hybridization assay. Therefore, the task will be accomplished having done this.

Please I need help with this

Answers

TAAGCCGATAAATGCTAACGGTA

The hypothalamic hormone that triggers the secretion of FSH and LH from the anterior pituitary is

Answers

Answer:

Hypothalamic-Pituitary-Gonadal Axis

GnRH produced by the hypothalamus stimulates the production of both LH and FSH. FSH functions by stimulating ovarian follicular development in females and regulating spermatogenesis in males. LH induces ovulation and corpus luteum formation in the ovaries.

plz give brainlist

hope this helped

Metals are useful in industry because they can be shaped without breaking. What is this property of metals called?

Answers

Answer:

malleable ................

Answer:

versatility ductility conductivity malleability

SIOM CSserials
What has a greater influence on protein levels?
(1 point)
Protein degradation has a greater influence because outside factors like antibiotics can
cause it, and it is difficult to recover from.
O
Protein degradation has a greater influence because they are denatured faster than the cell
can produce them.
mRNA destroyer concentration has a greater influence because it is destroying mRNA before
proteins can even be produced.
mRNA destroyer concentration has a greater influence because mRNA is destroyed right
after the proteins are produced.

Answers

Answer:

mRNA destroyer concentration has a greater influence because it is destroying mRNA before  proteins can even be produced.

Explanation:

Proteins are synthesized from mRNA through the process of translation. mRNAs are first synthesized from a coding DNA template through the process of transcription. Hence, if mRNAs are destroyed, it means proteins will not be synthesized at all.

Protein not being synthesized at all means that mRNA destroyer concentration has a greater influence on protein levels than protein degradation. With protein degradation, not all the protein is degraded at once and some quantity of the protein can still be found, but with mRNA destroyer concentration, no protein can be found at all because it was not synthesized in the first place.

Three living species X, Y, and Z share a common ancestor T, as do extinct species U and V. A grouping that consists of species T, X, Y, and Z (but not U or V) makes up Three living species X, Y, and Z share a common ancestor T, as do extinct species U and V. A grouping that consists of species T, X, Y, and Z (but not U or V) makes up a polyphyletic group. an ingroup, with species U as the outgroup. a paraphyletic group. a monophyletic clade. a valid taxon.

Answers

Answer:

Explanation:

Creative Bioarray has developed and validated the 3T3 neutral red uptake photoxicity assay, erythrocyte hemolysis assay and a phototoxicity screening assay using 3D human epidermis model.

https://dda.creative-bioarray.com/pharmacology-models.html

Name four breeds of cattle

Answers

Answer:

Black Angus, Red Angus, Holstein, Gelbvieh

Hope this helps!

Which function is specific to the neuron? It generates electrochemical signals so that the body can react to stimuli. It produces antibodies to destroy pathogens for protection purposes. It breaks down chemical substances into a form that is usable by the body. It delivers oxygen to the cells of the body for metabolic processes.

Answers

Answer:

It generates electrochemical signals so that the body can react to stimuli.

Explanation:

This is the job of the nervous system; it allows our body to react to stimuli. Neurons are what allows us to feel if something is touching our body (or if we are touching something) by sending synapses all the way to the brain at an incredibly fast pace.

Answer:

It generates electrochemical signals so that the body can react to stimuli.

Explanation:

edge 2022

Which statement below correctly describes what the model shows? *
1​

Answers

Answer:

I reckon it's part D.

Explanation:

what mode of nutrition is house fly​

Answers

Answer:

Houseflies do not have chewing mouthparts like a cockroach or piercing-sucking mouthparts like a mosquito. They regurgitate digestive enzymes, soften and liquify the food material, and then they sop it up with their sponging mouthparts.

Hope this makes sense and helps

Evaluate this statement: Gene flow increases the genetic divergence of populations. Evaluate this statement: Gene flow increases the genetic divergence of populations. This statement is true. This statement is false. Gene flow is not able to influence the genetic divergence of populations. This statement is false. Gene flow reduces the divergence of populations. This statement is false. Gene flow increases the number of genes in populations.

Answers

The correct answer is C. This statement is false. Gene flow reduces the divergence of populations.

Explanation:

In biology and related areas, genetic divergence occurs if populations with a common ancestor develop unique traits, which are the result of genetic changes over time. On the other hand, gene flow occurs when traits including genes flow from one population to another, usually because the populations are in contact. In this context, gene flow reduces divergence because if genetic material flows between populations is less likely each population can develop unique traits, instead the populations involved will have similar traits after some time.

The correct answer is C. This statement is false. Gene flow reduces the divergence of populations.

The following information should be considered;

In terms of biology and related areas, genetic divergence arise at the time when the populations are with a common ancestor that created unique traits, due to this there are genetic changes over time. While gene flow arise at the time when traits involved genes flow from one population to another, normally due to the populations are in contact. In this given situaton, gene flow reduces divergence since genetic material flows between populations is less likely every population can create unique traits, rather the populations involved will have similar traits.

Learn more: https://brainly.com/question/5303391?referrer=searchResults

13. List 4 safety symbols that would be seen if you are working with a material that is biohazard, such as bacteria.

Answers

Answer:

1. Skull and crossbones

2. A triangle (commonly painted colour red or yellow) with an exclamation sign inside.

3. biohazard symbol

4. A radiation sign in the form of a triangle, having other little image descriptions inside.

Explanation:

Note that a biohazard material refers to dangerous substances of biological (living) nature that can pose a threat to humans. Thus, safety symbols try as much as to draw attention to the descriptions used.

For example, skull and crossbones and biohazard symbols are used to indicate that a material that is biohazard, such as bacteria could result in the death of a person.

marasmus is caused due to diet insufficient in (a) proteins (b) carbohydrates (c) fats (d) all of these

Answers

The Appropriate answer:

[tex] \large{ \boxed{ \bf{ \color{red}{Carbohydrates(B)}}}}[/tex]

Explanation:-Bread and cereal group includes food made from grains auch as rice, wheat and corn. They are rich in carbohydrates and theh give energy to our body to work and play.Our body needs certain nutritional needs, and jf they aren't fulfilled, then chances of deficiency diseases increases. Deficiency of Carbohydrates causes Marasmus. The body losses activeness, bodyaches are frequent.

Explore more:-Carbohydrates are made up of three elements: Carbon, Hydrogen and oxygen.There are simple or complex polysaccharides which also determines the simplicity of carbohydrates.

━━━━━━━━━━━━━━━━━━━━

Write TRUE or FALSE
(a)
A 'system' is the part of an organism that carries out a certain function.​

Answers

Answer:

TRUE

Explanation:

Muscle cell are richer in lysosomes , as they require lot of energy. correct and rewrite the following statement.

Answers

Answer:

See below

Explanation:

The correct statement is:

=> Muscle cells are richer in mitochondria, as they required lots of energy.

Mitochondrion acts as power house of the cell providing the cell with the required energy.

Correct Statement:-

Muscle cells are richer in Mitochondria, as they require a lot of energy.

[tex] \large{ \underline{ \boxed{ \pink{ \rm{Explanation}}}}}[/tex]

Especially in Skeletal muscles, Mitochondria and glycogen granules are found in abundance. Our limbs that includes our arms and legs shows movement which needs energy. The food is oxidized and energy is released.

More to know:-Mitochondria is popularly known as Power house of the cell or ATP generation site.It is a double-membranous structure with outer membrane smooth and inner membrane surrounds the matrix.The inner membrane have cristae which increase surface area.The cristae bear Oxysomes or F0-F1 particles.Mitocondria is semi-autonomous, it have it's own DNA and ribosomes.

━━━━━━━━━━━━━━━━━━━━

PLEASE ANSWER ASAP!!!!!!!! ITS DUE IN 5 MINUTES.

1.) How do organisms benefit from Mitosis? Write a paragraph using at least five sentences.


Answers

Answer:

Organisms benefit from mitosis because mitosis helps regenerate cells. This helps them recover from injuries and more.

Explanation:

True or False: Polar molecules do not have a difference in electrical charge.

Answers

Answer:

false

Explanation:

nonpolar molecule has no separation of charge, so no positive or negative poles are formed

Which of the following items was Darwin able to use to study the structures of
extinct organisms?
A. Fossils
O B. Species
O C. Amino acids
O D. Adaptations

Answers

Answer:

a

Explanation:

because that is all he had left of extinct animal's.

Answer:

A

Explanation:ithink not sure

Question What was the ratio of tall to short plants in the F2 generation of Mendel's experiments? A. 3:1 B. 2:1 O C. 1:1 D. 6:1 ​

Answers

Answer:

A

Explanation:

Answer: 3:1

Explanation:

i got it right on the test

Use the image to answer the question below: Using the model presented, what process is being depicted? A) An electrical signal being converted to a chemical signal B) Salutatory conduction C) The transfer of neurotransmitters between axons D) The path of a steroid hormone

Answers

Answer:

option A is correct because of it is undergoing a convertion

Explain how scientific knowledge develops through making observations about the natural world.

Answers

Answer:

Scientific knowledge develops through making observations about the natural world. An observation may generate a scientific question, which may lead to a hypothesis. The hypothesis can be tested through experimentation. The results of experimentation lead to changes in scientific knowledge.

Explanation:

Explain how scientific knowledge develops through making observations about the natural world.  my answers are never wrong trust me

Beyond changes in relationships described above, explain what other characteristics of man changed after the Fall.

Answers

Answer:

The consequences of the fall was man and woman will die man turned to mortal and will turn back into dust. woman would bring children in pain. relationships between husband and wife would be difficult. The ground was cursed labor would be very hard. human was banned from the paradise and the garden. no longer would they enjoy the holiness and justice they had in paradise.

Explanation:

How are the proteins inside your body affected by the presence of water and other molecules?

Answers

Answer:

Our body is constitute of several essential molecules such as proteins, fat, carbohydrate, water, and other molecules.

Each molecule has some of the impact of other molecules in the body. Impact of water and other molecules on proteins inside the body are as follows:

Proteins have ligand-binding site and water provide stability to the ligand-binding site of proteins through its hydrogen bonds.Conformational flexibility and transitions of proteins are due to the presence of water molecules in it.Disbalance in the pH of body due to changing concentration of sodium-potassium ions can denature the protein. Enzymes present in the body can control the rate of formation of proteins in the body.

Which structure is located between the trachea and a bronchiole? A. epiglottis B. pharynx C. alveolus D. bronchus

Answers

the correct answer is the bronchus

Shivering and vasoconstriction would be signaled to cause a: A. increase in pH. B. decrease in temperature. C. decrease in pH. D. increase in temperature.

Answers

Answer:D

Explanation: shivering occurs when someone is cold and vasoconstriction is when the blood vessels close to the skin and the veins closer to the skin surface constrict as a result of dat air doesn’t enter the body

Vasoconstriction is the narrowing of the blood vessels that hinders blood flow. Vasoconstriction and shivering will lead to an increase in the temperature through thermoregulation. Thus, option d is correct.

What is thermoregulation?

Thermoregulation is the maintenance and balancing of the temperature and heat in the body. They are regulated by many factors including shivering and vasoconstriction.

During the vasoconstriction, the blood vessels close to the skin surface close and the body shivers as a result of cold or decreased temperature. This signals the body to increase the temperature so that shivering can be stopped.

Therefore, vasoconstriction and shivering signal the body to increase the temperature.

Learn more about thermoregulation here:

https://brainly.com/question/7450241

#SPJ2

how can evidence from an experiment in relationship to the hypothesis ​

Answers

Answer:

The Hypothesis is a prediction based on the theory being tested.

The evidmence can support the Hypothesis or invalidate the Hypothesis.

Explanation:

Can someone describe these:
Menstrual Phase
Follicular Phase
and Luteal phase

Thanks!!!

Answers

Answer:

(menstrual phase) this is the phase where the unfertilized ovum and endometrium that was formed in readiness for implantation slough off or come out due to a sudden drop in progesterone levels

(follicular phase) this is where the graafian follicle in the ovary develops. from primary follicles due to secretion of follicle stimulating hormone by the pituitary gland and matures there after due LH hormone which will also stimulate the ovary to release the ovum

(luteal phase)this is the phase after the ovum has been released where the remains of the ruptured graafian follicle undergo reorganization to form a corpus luteum/yellow body which now produces progesterone which causes thickening of endometrium in readiness for implantation

hope this helps

Answer:

The menstrual cycle is the regular natural change that occurs in the female reproductive system that makes pregnancy possible. 2) The follicular phase is a phase of the estrous cycle during which follicles in the ovary nature from primary to a fully mature grafian follicle.It ends with ovulation.3) The luteal phase begins during the second half of a menstrual cycle normally lasting around 12 14 days after the ovulation and it is responsible for producing progesterone.

Other Questions
Given the set of data: 24, 43, 65, 12, 31, 78, 43, 24, 25, 18, 29, 53, 18, 23, 20, 43, 53, 25 a. Find the mode. b. Find the median. c. Find the mean, to the nearest tenth. d. Find the midrange. e. Find the standard deviation, to the nearest hundredth. f. Determine the quartiles. PLEASE HELPFind the area and the perimeter of the shaded regions below. Give your answer as a completely simplified exact value in terms of (no approximations). The figures below are based on semicircles or quarter circles and problems b), c), and d) are involving portions of a square. Perhaps you wanted pizza for dinner, but were out voted by the rest of the family who wanted chili. This is similar to what happens in a community. One person has to give up a right for the good of the group. Sometimes citizens' duties and rights conflict with each other. A good example is a public protest. People have the right to meet in groups and share ideas. However, a protest can disrupt traffic or other normal activities. A city must provide extra police protection to keep people safe. Therefore, the city has the right to require permission in advance for a protest. Government must make laws to balance the rights of individuals and different groups of people. To what is a family compared to in this paragraph? Voting Community Public protest Laws and rights A bar magnet is dropped from above and falls through the loop of wire. The north pole of the bar magnet points downward towards the page as it falls. Which statement is correct?a. The current in the loop always flows in a clockwise direction. bThe current in the loop always flows in a counterclockwise direction. c. The current in the loop flows first in a clockwise, then in a counterclockwise direction. d. The current in the loop flows first in a counterclockwise, then in a clockwise direction. e. No current flows in the loop because both ends of the magnet move through the loop. State whether the given measurements determine zero, one, or two triangles. A = 58, a = 25, b = 28 What is the solution to 5x - 15 = 5(-4x - 3) ? Group of answer choices -12 6 0 -16 You meet with the financial aid office to discuss your costs for attending LSU next semester.Tuition is $113.67 per credit hour, and fees are a flat rate of $660. You have a grant of $350 and a scholarship of $400. If you are taking 15 credit hours what amount will you need go pay for your classes next semester? Show you work Complete the square to transform the expression x2 - 2x - 2 into the form a(x - h)2 + k In ancient Greece, the marketplace in the center of a city-state was referred to as____ . a. the acropolis c. the agora b. the Minoan d. Knossos Help and show work please. Have been celebrating is a noun or a verb Angela took a general aptitude test and scored in the 90th percentile for aptitude in accounting. (a) What percentage of the scores were at or below her score? % (b) What percentage were above? g According to the CAPM, what is the expected rate of return for a stock with a beta of 1.2. when the risk-free rate is 6% and the market rate of return is 12% Who is the Greek god of wine? The accounting principle that requires important noncash financing and investing activities be reported on the statement of cash flows or in a footnote is the:\ PLEaSE HELP!!!!!! will give brainliest to first answer In this unit, you learned about ancient civilizations that existed in Asia and the Americas. What were the major achievements of each civilization? Of the achievements that you identified, which do you think had the biggest significance in world history? Why? Suppose you have a bag with the following in it: 5 one dollar bills, 4 fives, 3 tens, 5 twenties, and 3 fifties. Assuming the experiment requires drawing one bill from the bag at random, complete the probability distribution for this experiment.Required:What is the probability of drawing 9 dollars or less in a single draw? Suppose Cho is considering emigrating from her home country.A fictional country of Flaxon has the same policies and institutions as Cho's home country, except that it has greater price stability. If Cho's decision to emigrate is based solely on the prospects for economic growth, she would ignoring taxes what is the effect on earnings in the year after the shares are granted to executives