Why is biodiversity important for ecosystems?
Answer:to stop from extinction
Explanation:
The charged particles in the beams that Thomson studied came from atoms. As these particles moved away from their original atoms, they formed a visible beam. The current model of the atom includes protons, neutrons, and electrons.
What is the best use of an atomic model to explain the charge of the particles in Thomson’s beams?
An atom’s negative particles are surrounded by positive matter, so the positive particles are easier to remove.
An atom’s positive particles are surrounded by negative matter, so the negative particles are easier to remove.
An atom’s smaller negative particles are at a distance from the central positive particles, so the negative particles are easier to remove.
An atom’s larger positive particles are at a distance from the central negative particles, so the positive particles are easier to remove.
The question to the above information is;
What is the best use of an atomic model to explain the charge of the particles in Thomson's beams?
Answer;
An atom's smaller negative particles are at a distance from the central positive particles, so the negative particles are easier to remove.
Explanation;
-Atoms are comprised of a nucleus consisting of protons (red) and neutrons (blue). The number of orbiting electrons is the same as the number of protons and is termed the "atomic number" of the element.
J.J. Thomson discovered the electron. Atoms are neutral overall, therefore in Thomson’s ‘plum pudding model’:
atoms are spheres of positive chargeelectrons are dotted around insideAnswer:
Its C on edge
Explanation:
what is a global fire
Answer:
a wild fire of a spreading fire that reaches a global span
Explanation:
Eukaryotic cells can be specialized for specific tasks in multicellular organisms
true
false
write the code for RNA from this DNA STRAND :
AAAAAATTTTTTCCCGGGGTTTATATATC
Answer:
UUUUUUAAAAAAGGGCCCCAAAUAUAUAG
Explanation:
All you have to do is apply the same concept as DNA, but T (Thymine) is replaced with U (Uracil)
list one part of the cell theory in your own words, explain what it means
One part of the cell theory is that pre-existing cells can form more cells
This means that cells that currently exist are capable of creating more cells, however it’s a slow process
How does the force of gravity move objects in the solar system?
Answer:
One of the most noticeable effects of gravity in the solar system is the orbit of the planets. The sun could hold 1.3 million Earths so its mass has a strong gravitational pull. When a planet tries to go past the sun at a high rate of speed, gravity grabs the planet and pulls it towards the sun
Explanation:
An example of __ is the color of betta fish. When a RED fish (GG) is crossed with a YELLOW fish (gg), all of the offspring will be a ORANGE color (Gg)
Answer:
The correct answer is - incomplete dominance.
Explanation:
In the betta fish, there are different types of colors found in the fishes depends on the alleles present in their gene which follows incomplete dominance. Incomplete dominance is an inheritance pattern where a dominant allele does not mask completely and produce a blend of both alleles if present in heterozygous condition.
In the question, It is stated that when a cross between RED fish (GG) and a YELLOW fish (gg) produce orange color fish as offspring (Gg) which is a mix or blend of both alleles Red (dominant) and yellow (recessive).
Why are some theories more widely accepted than others such as the theory of evolution?
Answer:
Scientific theories is accepted as a scientific truth, supported by evidence collected by many scientists. The theory of evolution by natural selection is a classic theory. Keeping in mind a Hypothesis is a possible answer to scientific questions.
Explanation:
I majored in Biology
If a hydrocarbon chain has a carbon to carbon double bond then it is _______________.
Answer:
It is Alkene..........
Answer:
Alkenes
Explanation:
Alkene is a hydrocarbon chain that has a carbon to carbon double. Alkenes are considered 'acyclic' because it has one carbon to carbon double. Since they contain less than a maximum number of hydrogen atoms they are unsaturated.
Hope this helped
Which statement best explains the myth about how Romulus and Remus founded Rome?
Answer: Romulus defeated his brother, then founded Rome on one of the seven hills.
Explanation: Despite there is no answer choices, I'm thinking back on a little quiz I took, and it had the same exact question with the same exact answer choices, and that was the correct answer
Which is one of Edwin Hubble’s findings that supports the big bang theory?
The universe started at a central point.
Planetesimals formed in debris disks.
Visible matter only makes up about 5% of the universe.
The Milky Way is the only galaxy in the universe.
Answer:
A
Explanation:
Why is weather different from place to place?
Answer:
There are differences in climate around the world because of differing amounts of radiation received from the Sun at different parts of the Earth at different times of the year.
Explanation:
Hope this helps :)
Answer:
because according to where they are located, atmosphere brings different weather and temperature, and some places are further away from the sun, just like when it is day in one side but night on the other
Explanation:
“Fish and other wildlife become unhealthy and die without __________.”
Oxygen
Carbon Dioxide
Eutrophication
(This is 7th grade science)
Answer:
Oxygen
Explanation:
what RNA nitrogen bases match with the following DNA nitrogen bases?
Which plant propagation process insures some genetic diversity?
Answer:
Seed propagation takes place during sexual reproduction. The production of seeds through auto-pollination or crossed pollination ensures some genetic variation.
Explanation:
Seeds ensure the existence of genetic variation between plants. There are two general crossing systems in plants, which depend on pollination type.
Self-pollination occurs when the flower pollen is transferred to the same flower stigma, reaching that individual egg to fertilize it. These are autogamous systems. Crossed pollination occurs when the mature pollen is driven by different pollinator agents from one flower to another, reaching the other flower stigma and fertilizing its eggs. These are xenogamous systems.Sexual reproduction gives more possibilities to different alleles of a gene that did not appear in one generation to express in the next generation. Both types of pollination allow genetic variation, however by the occurrence of crossed pollination there are more chances to ensure the variability of the species and survival to environmental changes. While by self-pollination there are more chances to express the same genotype of the parental plant. The Xenogamous system has the advantage of avoiding the effects of endogamy in a population.
Which of the following foods are native to rainforests?
a. papayas
b. mangoes
c. Sugarcane
d. all of the above
Answer:
on edge here's the correct answer
Explanation:
Answer: It is D)
Explanation:
What is the purpose of the other tube of water?
Explanation:
cant see photo
Answer:
delude the other thing
there is no picture so i have no idea what your asking. ill edit this answer to be more specific when you explain
Explanation:
Which of these is an advantage of fossil fuels? *
O Reliable
O Large reserves
O Greenhouse gas emissions
O Non-renewable
Answer:
reliable
Explanation:
Explanation:
Fossil fuels are a non-renewable resource.
Which of the following solutions is neutral?
Group of answer choices
a solution with a pH of 14
a solution with a pH of 2
a solution with a pH of 7
a solution with a pH of 9
Flag this Question
Question 4
Potassium hydroxide has the chemical formula KOH. It feels slippery and is used in cleaning liquids. Based on this description, potassium hydroxide is most likely a(n)?
Group of answer choices
acid
base
neutral solution
pH indicator
first to answer gets the brinllest
Answer:
Kleenex
ekekkdkdkeeee
Why are bananas curved?
Answer:
It's because of the sun! Bananas are curved so they can retrieve sunlight. Bananas go through a process called 'negative geotropism'.What it means is that bananas grow away from the ground, instead of growing towards it, hence the 'negative' geotropism.
Explanation:
g.o.o.g.l.e lma o
Answer
It's because of the sun!
Explanation:
Bananas are curved so they can retrieve sunlight. Bananas go through a process called 'negative geotropism'. Meaning it grows away from the ground instead of towards it.
Select the letter of the correct answer.
Growers around the world produce about 3.2 x 107 metric tons of sunflowers each year. One
metric ton is the same as 1.1 short tons. How many short tons of sunflowers do worldwide
growers produce annually?
Answer:
3.5264 x [tex]10^{7}[/tex]
Explanation:
The metric ton is used as a unit of mass. The metric ton in British units can be represented as 2240 pounds or long ton whereas in United state is termed as 1.102 short ton.
In the given question, it has been mentioned that the growers around the world produce about 3.2 x [tex]10^{7}[/tex] a metric ton of sunflower.
So the short ton produced will be
= ( 3.2 x [tex]10^{7}[/tex] ) x 1.102
= 3.5264 x [tex]10^{7}[/tex] short ton.
Thus, 3.5264 x [tex]10^{7}[/tex] is the correct answer.
please help i will give brainlist
Answer:
I think it's c hope I hope I helped if not I'm sorry:(
17. What causes evaporation?
O Air that is unsaturated with water vapor comes into contact with the surface of the water
O Air that is cooler than the water comes into contact with the surface of the water
O Air that is warmer than water comes into contact with the surface of the water
O Air that is supersaturated with water vapor comes into contact with the surface of the water in
Evaporation occurs when air that is warmer than water comes into contact with the water's surface, hence option A is correct.
What is evaporation?As a liquid transforms into a gas, evaporation, a sort of vaporization, occurs on the liquid's surface. For instance, a high concentration of the evaporating substance in the surrounding gas significantly slows down evaporation when humidity affects the rate of evaporation of water.
It takes in moisture from garden soil as well as the biggest lakes and seas, and the level of the water will decrease when it is heated by the sun.
Therefore, solar energy, or heat from the sun, is what causes the evaporation process to occur, hence option A is correct.
Learn more about evaporation, here:
https://brainly.com/question/5019199
#SPJ5
Which of these describes a way in which humans could increase biodiversity in a marine ecosystem? A. They could introduce new species to the ecosystem. B. They could limit fishing to only one kind of fish in the ecosystem. C. They could ban boating,snorkeling,and scuba diving in the ecosystem. D. They could restrict the amount of each type of fish or shellfish harvested from the ecosystem
I need help with this (last question I had had the picture all black)
Answer:
I only know A
I think it's the lap
write a short paragraph on hydra
Answer:
at the moment i am thinking of 3 different hydra, marvel, mythical creature and creation on sexual reproduction between plants. If you could tell me the subject i could explain it to you. :)
Explanation:
Who is to blame climate change?
Scientists have measured global temperatures for over a hundred years and see that the Earth is getting hotter. Ice core data suggests the Earth should actually be cooling if it were following its natural cycles. The trend can be best visualized by comparing each year’s average temperature with the long- term average. Figure 1 shows observations of the world’s annual average temperature made by the National Oceanic and Atmospheric Administration (NOAA). In recent decades, the years have always been hotter.
Over geologic time, the Earth’s average temperature has changed as a result of the sun’s output, the tilt and position of the Earth in its orbit, and the concentration of greenhouse gases. Scientists have developed a good understanding of the natural variations in these factors by examining different data sources in order to estimate ancient temperatures. Observations tell us that these natural factors have not been changing over the last hundred years or so in a way that would explain the observed temperature increases.
In contrast, greenhouse gases have been changing in a way that can explain the observed temperature increases. Figure 2 shows the change in atmospheric CO2 concentration over the last thousand years. At the Scripps Institute of Oceanography in Hawaii researchers have been sampling pristine mountaintop air every month since 1958. Their observations show that both the concentration and isotopic composition of CO2 is changing, and is consistent with manmade sources, including the carbon emissions from burning fossil fuels. The industrial revolution marked a drastic increase in CO2 concentrations in the atmosphere when humans began using fossil fuels on a large scale.
Scientists attribute the global warming trend observed since the mid-20th century to the human expansion of the "greenhouse effect"1 — warming that results when the atmosphere traps heat radiating from Earth toward space. Certain gases in the atmosphere block heat from escaping. CO2 along with other gases are known as greenhouse gases. Over the last century the burning of fossil fuels like coal and oil has increased the concentration of atmospheric CO2. In its Fifth Assessment Report, the Intergovernmental Panel on Climate Change, a group of 1,300 independent scientific experts from countries all over the world under the auspices of the United Nations, concluded there's a more than 95 percent probability that human activities over the past 50 years have warmed our planet.
Give evidence and reasoning!!
Answer:
People
Explanation:
The energy we use and waste
Which statements accurately describe fermentation? Select two options.
Oxygen is present during this process.
Cells may convert pyruvic acid to lactic acid.
NAD+ is converted to NADH.
Fermentation is an anaerobic process.
Additional ATP is produced after glycolysis.
Answer:
The answers are the second and fourth ones.
Explanation:
I did the assignment.
The statements that accurately describe fermentation are cells may convert pyruvic acid to lactic acid, and fermentation is an anaerobic process. The correct options are B and D.
What is fermentation?Fermentation is an anaerobic chemical process that breaks down molecules like glucose. More specifically, fermentation is the bubbling that happens during the creation of wine and beer, a procedure that has been around for at least 10,000 years.
It is different from aerobic respiration because it occurs in the absence of oxygen and aerobic respiration occurs in the presence of oxygen. The product of fermentation is lactic acid, which is produced from pyruvic acid.
Thus, the correct options are: B, Cells may convert pyruvic acid to lactic acid, and D, Fermentation is an anaerobic process.
To learn more about fermentation, refer to the link:
https://brainly.com/question/14525128
#SPJ6
The formation of an ionic bond involves the
Select one:
O sharing of neutrons.
sharing of protons.
transfer of neutrons
transfer of electrons
Answer: transfer of electrons
Explanation:
