Answer: Ocean water is hypotonic to your body.
Explanation:
Why?
The osmotic pressure of of the ocean water is greater(dur to huge number Na+ ions) than that of our body.As a result ocean water is hypertonic with respect to our body.
a scientist discovers a new species of fossil tetrapod. the fossil consists only of a few scattered hard parts. which trait would be most likely to allow the scientist to identify the unknown as a mammal?
The trait which most likely allow the scientist to identify the unknown as a mammal would be differentiated teeth.
Fossil, remnant, impression, or hint of an animal or plant of a beyond geologic age that has been preserved in Earth’s crust. The complex of facts recorded in fossils globally known as the fossil file—is the primary source of information about the history of the existence of the world.
Only a small fraction of historic organisms are preserved as fossils, and generally, best organisms that have a stable and resistant skeleton are conveniently preserved. most major businesses of invertebrate animals have a calcareous skeleton or shell (e.g., corals, mollusks, brachiopods, bryozoans). other kinds have shells of calcium phosphate (which additionally takes place in the bones of vertebrates), or silicon dioxide. A shell or bone that is buried fast after deposition may additionally preserve these natural tissues, though they become petrified (transformed to a stony substance) over the years.
Learn more about fossils here:- https://brainly.com/question/20158226
#SPJ4
if you eat a candy bar, sugar enters your digestive system. some of that sugar eventually leaves the body through the urinary system. where is the body's last chance to take the sugar and recirculate it into the bloodstream for use by cells before it is excreted as urine?
Swallowing sugar, food passes through your oesophagus and into your stomach, where it is diluted by digestive juices in preparation for later passage through the rest of your digestive tract.
Sugar and carbohydrate sugars move quickly through your stomach and start to break down in your small intestine. With the aid of digestive enzymes found in the lining of your small intestine, all types of sugar are converted into the tiniest sugar molecules. Once sugar has broken down into a monosaccharide, or single molecule, it is absorbed via the intestine and turned into glucose in your blood. In order to remove blood glucose from your body and distribute it to various cells throughout your body for use as fuel, your pancreas secretes the hormone insulin.To know more about blood check the below link:
https://brainly.com/question/26214762
#SPJ4
which do you think would be able to move more easily, and why? the earthworm, because it uses two sets of muscles to help it move through the watery solution the nematode, because its whiplike motion will easily propel it through the watery solution the earthworm, because it can contract and expand its muscles to burrow down through the watery solution the nematode, because it can move its paddle-like appendages on its segments to help it move through the watery solution
Earthworms exude a slimy fluid to aid in mobility, which makes it simpler for them to travel on a rough surface than it is for them to do so on a smooth one.
The nematode's whip-like action will readily drive it through the watery solution surface the earthworm can contract and extend its muscles to burrow through the watery solution surface the nematode can move its paddle-like appendages on its segments to help earthworm to travel through the watery solution surface since it has two sets of muscles to assist it move through the watery solution. Longitudinal muscles traverse the length of the body, whereas circular muscles loop around each section.
The complete question is:
which do you think earthworm would be able to move more easily, and why?
learn more about earthworm here:
https://brainly.com/question/13938105
#SPJ4
if you are considered prehypertensive, what are some steps you can take to lower your blood pressure?
Answer:
67%
Explanation:
at the end of which week of the ovarian cycle should implantation occur (assuming there is an embryo)?
Answer:
first week
Explanation:
it takes 2 to 3 days tk get embryo
notch is a receptor protein displayed on the surface of certain cells in developing fruit fly embryos. notch’s ligand is a membrane-bound protein called delta that is displayed on the surface of adjacent cells. when notch is activated by its ligand, the intracellular tail of the notch protein becomes separated from the rest of the protein. this allows the intracellular tail to move to the cell’s nucleus and alter the expression of specific genes.
Delta's role in regulating cell communication through the Notch signaling pathway is that Delta restricts cell communication to short distances within a developing embryo.
What is cell communication?Chemical signals are typically used by cells to communicate. These chemical signals, which are proteins or other molecules made by the sending cell and released into the extracellular space, are frequently secreted by the cell. They can then travel to nearby cells by floating there, much like messages in a bottle.
During the development of fruit fly embryos, the receptor protein notch is visible on the surface of some cells. The protein delta, which is membrane-bound and expressed on the surface of neighboring cells, is the ligand for the notch. The intracellular tail of the notch protein separates from the rest of the protein when notch is activated by its ligand. Consequently, the intracellular tail can move to the cell's nucleus and change the way some genes are expressed.
Learn more about cell on:
https://brainly.com/question/13123319
#SPJ1
suppose a mutation happened within an intron of a gene. could this affect the gene's expression? why or why not?
An intron mutation would have no impact on a protein's amino acid sequence unless it happened inside the 5′, 3′, or branch point splices, which are eliminated before translation.
Would the expression of a gene be impacted by an intron mutation?A point mutation or even a sizable deletion in the intron would probably not appreciably lower the expression of the gene unless splicing was affected since the intron regions that affect mRNA accumulation are redundant and scattered.
What takes place if an intron is altered?a genetic change in the DNA sequence that takes place at the exon-intron boundary (splice site).
Learn more about DNA here:
https://brainly.com/question/2905713
#SPJ4
What has the greatest influence on windspeed
The primary factor affecting wind speed is the pressure gradient between high and low pressure locations.
What affects the wind's velocity?
The difference in pressure between high- and low-pressure zones is known as a pressure gradient.
The pressure gradient and wind speed are intimately correlated, so as the pressure gradient (i.e., change in pressure) grows, the wind speed at that place also increases.
What influences wind speed the most?
Because the sun heats the Earth differently in different regions, creating pressure differences, wind is a result of a horizontal variation in air pressure, therefore the sun is the primary source of most winds.
To learn more about Primary Sources
Visit:
https://brainly.com/question/29771183
#SPJ1
Drag the terms to the correct boxes to complete this infographic on the general parts of the eukaryotic cell. Cell Wall External Chromosomes Internal Mitochondria Cytoskeleton Glycocalyx Cilia Ribosomes Boundary EUKARYOTIC CELL Cytoplo membrane Append Nu Homebound Olle Endoplasmi reculum Coleratu Flagella Nuclear envelope Muide Mikrotubules Intermediate laments Actin laments chlo
A nucleus and other membrane-bound organelles are found in the cells of eukaryotes, which are creatures.
What are eukaryotic cells?A nucleus and other membrane-bound organelles are found in the cells of eukaryotes, which are creatures. All mammals, plants, fungi, protists, and the majority of algae are eukaryotic creatures, as are many other types of life. Single cells or many cells can make up eukaryotes.
Eukaryotic cells are comprised of 3 major compartments. There are two different kinds of glycocalyx and appendages in the exterior compartment.The boundary can consist of a cell membrane and possibly a cell wall as well. The internal compartment is comprised of the cytoplasm, the nucleus, cytoskeletal components, and other organelles, such as mitochondria and ribosomes.To learn more about Eukaryotic cells refer to:
https://brainly.com/question/495097
#SPJ4
When there is no pattern to a
population's growth, it is known as
A. cyclical
C. irruptive
B. declining
D. irregular
When there is no pattern to a population's growth, it is known as irregular and is therefore denoted as option D.
What is Population?This is referred to as the total number of organisms in an area over a given period of time and population growth could either be increasing, decreasing or being stable.
There are four types of population growth and they include the following below:
StableIrruptiveCyclicIrregular.A stable population growth occurs when there is a constant age-specific fertility and mortality rates over a long period of time. On the other hand, an irregular population growth is the one in which there is no pattern and it results in a chaotic behavior in population size which is therefore the reason why option D was chosen as the correct choice.
Read more about Population growth here https://brainly.com/question/1437549
#SPJ1
what difference, if any, would you expect in the rate of cellular respiration in the germinating peas in vial
The nongerminating peas will show a smaller change in gas volume compared to the germinating peas due to cellular respiration. This is the correct answer.
The non-germinating peas do not require much ATP synthesis since, in addition to the germinating peas, they are not germinating. As a result, when compared to peas that are germinating, non-germinating peas have a substantially lower rate of respiration.
Compared to the peas that were germination, the non-germinating peas used much less oxygen. This is due to the fact that while both germinating and non-germinating peas are alive, the latter require a greater amount of oxygen to be used in order for the seed to keep growing and surviving.
Complete question:
What difference, if any, would you expect in the rate of cellular respiration in the germinating peas in vial #1 compared to the nongerminating peas in vial #2?
1.The nongerminating and germinating peas will show a similar rate of respiration, as both are alive.
2.The nongerminating peas will show a smaller change in gas volume compared to the germinating peas due to cellular respiration.
3.The germinating peas will show a smaller change in gas volume compared to the nongerminating peas due to production of O2.
4.The nongerminating peas serve as a second control and should show no volume change due to cellular respiration.
Learn more about rate of respiration from:
https://brainly.com/question/23542143
#SPJ4
The inner membrane of the mitochondria provides a large for breaking the bonds in sugar molecules.
Answer:
Explanation:
It maintains the proton gradient that drives oxidative phosphorylation.
The inner membrane of the mitochondria does provide a large surface area for breaking down the bonds in sugar molecules.
What is mitochondria?Mitochondria are organelles found in the cells of eukaryotic organisms, including animals, plants, and fungi. They are often referred to as the "powerhouses" of the cell because they are responsible for producing the majority of the cell's energy supply. Mitochondria have a double membrane structure, with an outer membrane and an inner membrane. The inner membrane is folded into small, finger-like projections called cristae, which increases the surface area of the membrane.
Mitochondria are the site of cellular respiration, a process by which energy is extracted from organic molecules, such as glucose, to produce the energy-rich molecule adenosine triphosphate (ATP). The energy released from this process is used by the cell to perform various functions, such as muscle contraction and protein synthesis.
Mitochondria also have their own DNA and reproduce independently of the cell. They are thought to have originated as a symbiotic relationship between ancient cells and bacteria. They have their own genetic material, which suggests that they have a separate evolutionary history from the rest of the cell.
Learn more about mitochondria, here:
https://brainly.com/question/10688306
#SPJ2
fats that cannot be transported by the bloodstream are absorbed by the that are located in the villi that line the small intestine.
Lacteals. One of the lymphatic vessels, the lacteal, which supplies the small intestine with nutrients, becomes white following a meal as a result of the tiny fat globules in its lymph (see chyle).
The Italian physician and professor of anatomy and surgery Gaspare Aselli, who first discovered the lacteals in the late 16th and early 17th centuries, called them venae albae et lacteae ("white and milky fat veins"). The lacteal capillaries, which are the tiniest of the lacteals and are each a tiny capillary running along the middle of a villus, or finger-like extension, in the mucous membrane lining the small intestine, are the smallest lacteals. The submucosa, a connective tissue layer right below the mucous membrane, is where the lacteal capillaries empty into lacteals.
Learn more about fat
https://brainly.com/question/11119111
#SPJ4
match each term to its defention
Answer: Can you add the image?
Explanation: There is nothing here.
modern humans have: a. large browridges, large nasal sinuses, and a large masticatory complex. b. a high vertical forehead, a round and tall skull, and small browridges. c. a small face, small teeth, and a projecting chin. d. both b. and c.
Modern humans have traits a high vertical forehead, a round and tall skull, and small browridges
The lighter skeletons of modern humans can be used to identify them anatomically from ancient humans. Modern humans have extraordinarily large brains, which vary in size from population to population and between males and females. The average size of these brains is approximately 1300 cubic centimetres.
Many of the physical and behavioural traits that modern humans have evolved share some similarities with other early human species, though not to the same extent. Modern humans were able to connect with their environment and one another in novel and unusual ways thanks to their complex minds. Our predecessors were better able to survive as the environment got more unpredictable thanks to larger brains.
To learn more about modern humans refer here:
https://brainly.com/question/28039960
#SPJ4
Arrange these phases in the partial life cycle of a star in order, starting with the earliest event.
In heavy stars, the core contracts, pulling the outer
layer inward. Hydrogen fusion begins in the outer
shell. The outer shell expands, and the light
generated increases.
The hydrogen supply in the core starts to run out.
The outer shell expands, cools down, and starts
to glow red.
Stars that have roughly more than three times the
mass of our Sun become black holes.
The Arrangement of the phases in the partial life cycle of a star in order, starting with the earliest event are:
In heavy stars, the core contracts, pulling the outer layer inward. Hydrogen fusion begins in the outer shell. The outer shell expands, and the light generated increases.Stars that have roughly more than three times the mass of our Sun become black holes.The hydrogen supply in the core starts to run out. The outer shell expands, cools down, and starts to glow red.What is the life cycle of a star definition?Through their "lifecycle," which is a continuous process of formation, fuel burning, and material dispersal when all the fuel is used up, stars produce the elements that make up the cosmos.
In general, a star's life span is shortened and its fuel supply is burned up faster as it becomes more massive. Even the largest stars, after only a few million years of fusion, can burn out and go supernova. On the other hand, a star the size of the Sun can continue fusing hydrogen for roughly 10 billion years.
Therefore, Massive stars explode as supernovae, neutron stars, and black holes, but common stars like the sun end their lives as white dwarfs encircled by planetary nebulae that eventually fade away. No matter how big or small, all stars go through the same 7 stage cycle.
Learn more about partial life cycle of a star from
https://brainly.com/question/3554363
#SPJ1
Which of the following are true about eukaryotic cells? There are 5 correct answers.
Question 16 options:
first cells, prefix meaning "before," thought to be early cells
have organelles and nucleus
large and complex
have ribosomes
have a cell membrane
no nucleus or membrane bound organelles
small and simple
have DNA
Eukaryotic cells have organelles and nucleus, they are large and complex, have ribosomes, have a cell membrane and have DNA in their nucleus which is membrane- bound.
Organelles of a cell are what?An organelle found inside a certain type of cell is a specialised unit that serves a particular purpose. There are many different cell organelles, some of which are present in all types of cells, such as cell membranes, nuclei, and cytoplasm. But other organelles, like plastids and cell walls in plant cells, are unique to a certain kind of cell.
How do ribosomes work?All cells contain ribosomes, which are macromolecular organisms responsible for the biological synthesis of proteins (mRNA translation). To create polypeptide chains, ribosomes combine amino acids according to the codons found on messenger RNA (mRNA) molecules.
To learn more about eukaryotic cells visit:
brainly.com/question/11351358
#SPJ1
Polymers are made of small units called
the answer is monomers
Answer: Monomers
Explanation: Can I have brainliest?
calculate the maximum sustainable yield for a population whose carrying capacity (k) is 80,000 and whose per capita rate of growth (r) is 0.2.
The maximum sustainable yield is 4000 yields/ month.
The entire range of human beings or population in a country or region. : the full of people occupying an area or making up a whole.
There are too many of us to percentage the Earth pretty with different species and with future human generations, Earth is overpopulated.
Solution:
From the questions, we get the following information,
K=80,000 r=0.2
Therefore, we apply logistic growth equation,
dN/dt= rN[1-N/K]
Where, N is the maximum population size, which equals K/2
therefore N=K/2
=80,000/2
=40,000
Here, we get
dN/dt= rN[1-N/K]
=(0.2)(40,000)[1-(40,000)/80,000]
=8000[1-1/2]
=8000[(2-1)/2]
=8000*1/2 OR 8000*0.5
=4000 yields/ month
Learn more about population here:- https://brainly.com/question/13403673
#SPJ4
The Energy Pyramid is used to illustrate how energy gets transferred from one organism to another. Explain what organisms types are involved and how some energy gets lost.
Answer:
The Energy Pyramid is a visual representation of how energy is transferred from one organism to another in an ecosystem. The pyramid shows the relationship between different levels of the food chain, with the primary producers at the bottom, followed by the primary consumers, the secondary consumers, and so on.
At the base of the pyramid are the primary producers, which are typically plants or algae that convert sunlight into energy through photosynthesis. These primary producers are then eaten by primary consumers, which are herbivores that feed on the plants. In turn, the primary consumers are eaten by secondary consumers, which are carnivores that feed on the primary consumers. This process continues up the pyramid, with each level representing a trophic level.
As energy is transferred from one organism to another, some of the energy is lost through processes such as respiration, excretion, and the production of waste. This is why the pyramid narrows at each higher level, as there is less energy available to support the organisms at that level. The loss of energy at each level means that there are fewer organisms at higher levels of the pyramid.
long-term potentiation enhances the release of which neurotransmitter into the synaptic cleft, resulting in enhanced learning?
Long-term potentiation (LTP) typically happens at synapses where the sending neuron releases the neurotransmitter glutamate into the synaptic cleft—the area between the sending and receiving neurons.
Over the past 40 years, much research on long-term potentiation (LTP) of excitatory synaptic transmission in the hippocampus has been conducted. However, the precise location and manner of LTP expression continue to be debatable matters.
Both pre- and postsynaptic contributions to LTP expression have received a lot of support. Although it is generally accepted that postsynaptic expression mechanisms play a major role in the production of LTP, the evidence for this assertion is susceptible to other explanations.
We quickly discuss some significant contributions to the "locus" controversy and discuss evidence in favor of presynaptic processes playing a major role.
Learn more about " Long-term potentiation (LTP) " to visit here;
https://brainly.com/question/28198068
#SPJ4
I need help please
Which organs work together in the respiratory system of a hamster to help it breathe? OA. Spinal cord and nerves B. Lungs and windpipe C. Gills and gill filaments OD. Lymph nodes and lymph
Answer:
B. Lungs and windpipe
Hope helps:")
Net primary productivity is the primary productivity of an ecosystem, after subtracting energy lost in
A. dead plant tissues.
B. inedible plant tissues.
C. respiration by primary producers.
D. respiration by primary consumers.
E. inefficiencies of photosynthesis.
Net primary productivity is the primary productivity of an ecosystem, after subtracting energy lost in C. respiration by primary producers.
What is the primary productivity of an ecosystem?In ecology and biology, the primary productivity of an ecosystem can be defined as a process in which the photosynthesis rate of all plants or algae is measured having into account their respiratory rate, which is very useful to determine the net primary productivity of such ecosystem in certain conditions.
The primary productivity of an ecosystem also allows for determining the net biomass that may be generated by the producer in certain conditions of the ecosystem.
Therefore, with this data, we can see that the primary productivity of an ecosystem can be defined as the amount of energy produced by the photosynthesis of autotrophs in the ecosystem having into account their respiratory rate.
Learn more about the primary productivity of an ecosystem here:
https://brainly.com/question/16129377
#SPJ1
methylation regulates transcription a. via the addition of a methyl group to cytosine bases of dna. b. via the addition of a methyl group to cytosine residues on rna polymerase ii. c. via the addition of a methyl group to cysteine residues on rna polymerase ii. d. via the addition of a methyl group to cysteine bases of dna.
Option A, methylation regulates transcription via the addition of a methyl group to cytosine bases of DNA.
DNA methylation controls gene expression by attracting proteins implicated in gene repression or by preventing transcription factor(s) from binding to DNA. De novo DNA methylation and demethylation both play active roles in the dynamic process that alters the pattern of DNA methylation in the genome during development. DNA methylation, in general, inhibits transcription, and loss of methylation is linked to gene activation. In rare circumstances, DNA methylation might directly obstruct the binding of transcription factors.
The complete question is:
Methylation regulates transcription
a. via the addition of a methyl group to cytosine bases of DNA
b. via the addition of a methyl group to cysteine residues on RNA polymerase II
c. via the addition of a methyl group to cysteine basses of DNA
d. via the addition of a methyl group to cytosine resides on RNA polymerase II
e. by interfering with the chromatin remodeling process
learn more about methylation here:
https://brainly.com/question/7453747
#SPJ4
a community isgroup of answer choicespopulations of organisms and the abiotic factors in their environmentpetition for food between individuals in a population.multiple organisms of the same species living in a specific area.all the biotic and abiotic factors in an environment.populations of multiple species interacting with one another in a specific area.
Populations of organisms and the abiotic factors in their environment.
An ecosystem consists of all biotic and abiotic factors that affect its community. Ecosystem ecologists often focus on energy flow and nutrient recycling. An ecological community is a group of actually or potentially interacting species living in the same place.
Communities are linked by networks of shared environments and the influence of each species on others. An ecosystem is a geographical area where plants animals other living things weather and landscape work together to form a bubble of life. An ecosystem contains living or living parts and abiotic factors or non-living parts.
Learn more about The abiotic factors here:- https://brainly.com/question/12689972
#SPJ4
The type of escherichia coli that produces a verotoxin similar to the one produced by shigella dysenteriae is ________ e. coli.
which evolutionary innovation was most significant in helping tetrapods move to dry terrestrial environments?
The amniotic egg is an evolutionary innovation which was most significant in helping tetrapods move to dry terrestrial environments
An egg with extra-embryonic membranes and a shell is referred to as an amniotic egg. In contrast to more primitive egg forms, the amniotic egg is "air-breathing," which means it exchanges gases with the environment. Amniotic eggs were a crucial adaption for creatures that lived on land, including several mammals, birds, and reptiles. Amniotes are animals that lay amniotic eggs.
A group of tetrapod vertebrates known as amniotes includes mammals, birds, and reptiles. An egg with an amnion, an adaption to lay eggs on land or keep the fertilised egg inside the mother, is what distinguishes amniotes from other species.
Whether implanted as eggs or carried by the female, amniotic embryos are shielded and helped by a number of thick membranes. These membranes cover the amniotic sac, which envelops the developing foetus in eutherian mammals (including humans). The absence of a larval stage and these embryonic membranes set amniotes apart from tetrapod amphibians.
To learn more about amniotic egg refer here:
https://brainly.com/question/14791069
#SPJ4
explain the difference between arguing that humans (or other species) are fitness maximizers vs. adaptation executers.
Specifically, sociobiologists believe that the main goal of humans is to increase reproductive success, to be "fitness maximizers."
However, evolutionary psychologists believe humans to be "adaptation executors" or "mechanism activators." They believe the main goal of human beings is to solve the problems of survival ...
Persons would pay to donate to sperm banks, which is FALSE since sperm banks do not reflect ancestral conditions. Fitness maximizers are people who intentionally aim to maximize fitness.
Executors of adaptations: once we comprehend adaptations, we can explain bxr
Evolved adaptations are preferred by evolutionary psychologists.
"Individual creatures should be viewed more as adaption executors than as fitness maximizers, according to this statement."
Learn more about " fitness maximizers vs. adaptation executers" to visit here;
https://brainly.com/question/1831916
#SPJ4
Complete Question :-
Explain the difference between arguing that humans (or other species) are fitness maximizers vs. adaptation executers. Which argument is favored by evolutionary psychologists, in contrast to sociobiologists?
many cancer cells shut down expression of the bax or bak gene. how will the cancer cell benefit from this cellular change?
The cancer cell will profit from this biological alteration since the mitochondria will be less likely to produce cytochrome C, preventing apoptosis.
Contrary to popular belief, healthy mitochondria are necessary for the growth of cancer cells. Cancer cells frequently harbor mutations in the mitochondrial genes, but these abnormalities do not deactivate the mitochondrial energy metabolism; rather, they change the cytochrome C condition of the mitochondria's bioenergetic and biosynthetic processes. In mammalian cells, mitochondria are essential for initiating apoptosis. Members of the cytochrome C control how proteins are released from the area between the inner and outer membranes of the mitochondria.
learn more about cancer cell here:
https://brainly.com/question/373177
#SPJ4
original DNA: TACTTTAATCCCAAATTTACT
DNA: TACTTTAATCCCAAGTTTACT
mRNA: ?
amino acid: ?
what type of mutation is this: ?
Answer:
substitution mutation
Explanation:
The original DNA sequence is: TACTTTAATCCCAAATTTACT
The mutated DNA sequence is: TACTTTAATCCCAAGTTTACT
The mRNA transcribed from the mutated DNA sequence is: AUGAAAUUAGGGUUAAUUAGA
The amino acid sequence encoded by the mRNA is: Met-Lys-Ser-Trp-Lys-Lys-Ser
This is an example of a substitution mutation, in which a single nucleotide in the DNA sequence is changed. In this case, the original DNA sequence contains the nucleotide A at position 13, while the mutated sequence contains the nucleotide G at the same position. This change causes a different mRNA sequence to be transcribed and a different amino acid to be encoded. Substitution mutations can have a variety of effects on gene function, depending on the location and nature of the mutation. Some substitution mutations may have no effect, while others may cause the protein encoded by the gene to function improperly or not at all.
