Answer:
Assuming this is a true/false question, the answer would be false.
If a predator only preyed on one species, it would be at a disadvantage if the prey it feeds on gets wiped out in that region.
Therefore, your answer is False.
If water was removed from a plant's environment what would happen to the plant's glucose production?
Answer:
It would cease
Explanation:
If water is removed from a plant's environment, the plant's glucose product will cease. This implies that the plant will stop producing glucose.
Water is an essential ingredient for the production of glucose by plants. During the process of photosynthesis, green plants manufactures their food in the presence of sunlight. The water combines with carbon dioxide to produce glucose oxygen gas using sunlight energy. Without water, this reaction will not be possible to take place. Therefore, the production of glucose stops when there is no water.What do you call protozoa that you can see with the naked eye?
Answer:
Paramecium protozoa
Explanation:
because of their size (50-300 μ long) and the human eye can see things as small as about 100 µm and P.
Summarize in 2-3 sentences, how an RNA vaccine works to help protect you against
viruses?
I
Answer:
boost your immune system
Explanation:
Answer:
Vaccination is the process in which substances called antigens are introduced artificially into the body to stimulate the immune system, the set of cells that protects the body against infections .
Describe the process of absolute dating as it relates to igneous rock and the fossil record.
Answer:
Radiometric dating. Geologists use radiometric dating to estimate how long ago rocks formed, and to infer the ages of fossils contained within those rocks. ... When molten rock cools, forming what are called igneous rocks, radioactive atoms are trapped inside. Afterwards, they decay at a predictable rate.
Helpppppppppppppppppppppppppppppppppp
Answer:
umm i dont understand your question
Explanation:
How could one determine if two
unidentified organisms share a common
ancestor?
Answer:
Evolutionists determine that two organisms have a common ancestor is by looking at fossil evidence in different rock layers using the law of Superposition (Oldest layers are on the bottom, newest are on the top) and compare the skulls or other bones to each other in order of oldest to newest (or newest to oldest). Another way to determine this is to examine the amount of DNA a certain species shares with another species. An example of this would be that Humans share roughly 90% of our DNA with chimpanzees or the other Great Apes.
Explanation:
DNA
They can look at the DNA it's the most common one.
There are 4 pieces of evolution and they are
Fossils , Geography , Embryos / DNA , Anatomy
Fossils: Physical remains of species , Determine age, location, environment
Deeper layers = older
Geography: Proves species share common ancestors, depending on where
they live
DNA: BEST evidence because it’s the MOST ACCURATE
Similarities in the early stages of development
Similarities in DNA
More similarities = closely related
More differences = not related
Anatomy: Compare body parts of different species to see how they evolved
3 different structures:
Homologous (same structure, different function)
Analogous (similar structure, different organisms)
Vestigial (body parts that no longer serve a purpose)
All of that are in evolution
Hope it helped! ( Gave u my biology notes :D)
PLEASE HURRY I AM TIMED!!!
Are aliens real? Explain your answer.
Answer:
No, not according to any sciences (unless you mean aliens as in immigrants)
Explanation:
There is no way that we are the only living thing in the entire world. There has to be another species out there. They might be wondering if there is another living thing out in space too.
9. What is the difference betwen climate and weather?
Answer:
Climate is the long-term weather, like it is usually sunny in Florida,
Weather is the weather that you see every day, such as rainy.
Explanation:
Answer:
Weather reflects short-term conditions of the atmosphere while climate is the average daily weather for an extended period of time at a certain location.
Explanation:
The charged particles in the beams that Thomson studied came from atoms. As these particles moved away from their original atoms, they formed a visible beam. The current model of the atom includes protons, neutrons, and electrons.
What is the best use of an atomic model to explain the charge of the particles in Thomson’s beams?
An atom’s negative particles are surrounded by positive matter, so the positive particles are easier to remove.
An atom’s positive particles are surrounded by negative matter, so the negative particles are easier to remove.
An atom’s smaller negative particles are at a distance from the central positive particles, so the negative particles are easier to remove.
An atom’s larger positive particles are at a distance from the central negative particles, so the positive particles are easier to remove.
The question to the above information is;
What is the best use of an atomic model to explain the charge of the particles in Thomson's beams?
Answer;
An atom's smaller negative particles are at a distance from the central positive particles, so the negative particles are easier to remove.
Explanation;
-Atoms are comprised of a nucleus consisting of protons (red) and neutrons (blue). The number of orbiting electrons is the same as the number of protons and is termed the "atomic number" of the element.
J.J. Thomson discovered the electron. Atoms are neutral overall, therefore in Thomson’s ‘plum pudding model’:
atoms are spheres of positive chargeelectrons are dotted around insideAnswer:
Its C on edge
Explanation:
Which statement best explains the myth about how Romulus and Remus founded Rome?
Answer: Romulus defeated his brother, then founded Rome on one of the seven hills.
Explanation: Despite there is no answer choices, I'm thinking back on a little quiz I took, and it had the same exact question with the same exact answer choices, and that was the correct answer
Which statement is true about gold and helium?
A. They both occur as a gas at room temperature.
B. They are both made of subatomic particles.
C. They are both used in balloons.
D. One of made of protons and the other of only electrons.
Answer:
The answer is B
B. They are both made of subatomic particles.
identify and explain three environmental impacts of current agricultural methods
Explanation:
It is profit making practice but it causes increased level of pathogens.
It has increased the level of chemicals in our land and water.
It has increased levels of greenhouse gases in air.
What parts of the body make up the central nervous system
Answer:
brain and spinal cord
Explanation:
that's it
6B(SCIENCE) (6BB OOB)
4
What is the difference between evaporation and boiling? *
(1 Point)
A) There is no difference - they are exactly the same.
B) Evaporation, unlike boiling, occurs at all temperatures.
C) In evaporation, unlike in boiling, there is no state change.
D) In boiling, unlike in evaporation, the liquid volume reduces.
This question is required.
Which of the following are sources of extra nutrients that can cause algae to overgrow in water due to HUMAN activity? CAREFULLY select all options that apply. List the answers.
dissolved oxygen in water
treated waste water
viruses
combined sewage overflow (CSO)
fertilizers
cleaning products
dog poop on the streets of NYC
water running over rocks
(This is 7th grade science)
What kind of inheritance is horse color an example of?
A. Complete dominance
B. Incomplete dominance
C. Co-dominance
How does evolution result in reproductive success?
Answer:
Often when species evolve, they receive a trait that may make them live longer or make it where their survival chances are significantly increased. Which in turn can make their offspring stronger and able to live longer, therefore increasing their population.
What type of cell is more likely to replicate and replicate faster brain cell or hair cell
Answer:
hair cells is most likely to replicate faster than the brain cell
Explanation:
__________
HELP ASAP
Joe is experimenting to determine which liquid will cause bean plants to grow faster. He watered the plants with equal amounts of liquid and measured their height every other day. The plants are in the same pots with different soils and placed in the same location. Will Joe be able to obtain reliable data to write a supported conclusion?
Yes, because he is only observing the height of the plant.
Yes, because he is consistent with watering the plants.
No, because he used different soils.
No, because he uses only one type of plant.
Answer:
No, because he used different soils.
Explanation:
which liquid will cause bean plants to grow faster.
He watered the plants with equal amounts of liquid and measured their height every other day.
The plants are in the same pots with different soils and placed in the same location.
Ok so last statement made the experiment wrong.
As a constant variable the soil should be the same for all plants only the liquid should change
Is energy used or not?
Answer:
Explanation:
energy is used, everything uses energy especially living organisms
Answer:
Yes energy is used, it can be used in certain ways, like when you are running or walking, guess why you are able to do those because you have energy to do that.
Explanation:
What are gametes?
male and female reproductive organs
male and female reproductive tissues
male and female reproductive systems
male and female reproductive cells
Answer:
male and female reproductive cellsExplanation:
I hope it helps ❤❤Answer:
the last one
Explanation:
The incidence of cystic fibrosis, a recessive genetic disorder in the Caucasian population of United States, is 1 in every 2,500 individuals. Find the number of heterozygous carriers. (p + q = 1, p2 + 2pq + q2 = 1)
Answer:
The no. of heterozygous carriers = 0.0392
Explanation:
From the given information:
The incidence of this recessive disorder i.e. q² = 1/2500
q² = 0.0004
q = 0.02
From Hardy Weinberg's Equilibrium.
p + q = 1; &
p² + 2pq + q² = 1
∴
p + 0.02 = 1
p = 1 - 0.02
p = 0.98
So, the numbers of heterozygous carrier 2pq is:
= 2 × 0.98 × 0.02
= 0.0392
Which factor makes enzymes well-suited to the role of catalyst in a biochemical reaction?
A)Enzymes do not affect the energy of a reaction.
B)Enzymes slow down reactions so products can form.
C)Enzymes can be reused because they do not permanently bond with substrate.
D)Enzymes can only bind to other enzymes so the same product is formed each time.
Answer: C
Explanation: Once an enzyme binds to a substrate and catalyzes the reaction, the enzyme is released, unchanged, and can be used for another reaction.
Enzymes can be reused because they do not permanently bond with substrate.
What are Enzymes?
A biological catalyst called an enzyme is usually always a protein. It accelerates a certain chemical reaction in the cell. The enzyme is continuously employed during the reaction and is not destroyed. Each enzyme molecule found in a cell is unique and tailored to a particular chemical reaction.
Proteins called enzymes assist our bodies' chemical reactions move forward more quickly. For several processes, including digestion and liver function, enzymes are crucial.
Health issues might result from having too much or too little of a specific enzyme. Healthcare professionals can also use the enzymes in our blood to look for injuries and illnesses.
Therefore, Enzymes can be reused because they do not permanently bond with substrate.
To learn more about Enzyme, refer to the link:
https://brainly.com/question/14953274
#SPJ6
Molecules of DNA are composed of long chains of?
two long polynucleotide chains
A DNA molecule consists of two long polynucleotide chains composed of four types of nucleotide subunits. Each of these chains is known as a DNA chain, or a DNA strand. Hydrogen bonds between the base portions of the nucleotides hold the two chains together
Molecules of DNA are composed of long chains of nucleotides.
What are nucleotides?Nucleotides are the building blocks of DNA and RNA adenine (A), thymine (T), guanosine (G), and Cytosine (C. In RNA, uracil (U) is present instead of thymine.
The pentose sugar is the ribose sugar in RNA and deoxyribose sugar in DNA. In deoxyribose sugar, oxygen is absent from the 3' carbon.
Phosphate groups are attached through the 5-C of pentose sugar by an ester bond. One polynucleotide chain is formed when the phosphate of one nucleotide forms a phosphodiester bond with the sugar of another nucleotide.
A double-stranded structure is formed by base pairing between nucleotides. The adenine binds to thymine by two hydrogen bonds and guanine binds to cytosine by three hydrogen bonds.
Therefore the molecules of DNA are composed of long chains of nucleotides.
Read more about nucleotides, here
https://brainly.com/question/13185536
#SPJ6
write the code for RNA from this DNA STRAND :
AAAAAATTTTTTCCCGGGGTTTATATATC
Answer:
UUUUUUAAAAAAGGGCCCCAAAUAUAUAG
Explanation:
All you have to do is apply the same concept as DNA, but T (Thymine) is replaced with U (Uracil)
HURRY. Why is transcription said to be unidirectional?
Answer:
Transcription is unidirectional because you are copying only ONE side of the DNA. Remember that DNA is a double stranded helical structure. One strand of DNA is complementary to the other strand.
Explanation:
Rivers that have developed over a long period of time are found in wide valleys with flat, low-lying bottoms. These valleys were
created by the removal of rock and soil through the process of _____.
OA. deposition
B
C. erosion
•D. weathering
glaciation
Which best explains the role of plants in the nitrogen cycle?
Answer:
Assimilation
Explanation:
This is how plants get nitrogen. They absorb nitrates from the soil into their roots. Then the nitrogen gets used in amino acids, nucleic acids, and chlorophyll. ... When a plant or animal dies, decomposers like fungi and bacteria turn the nitrogen back into ammonium so it can reenter the nitrogen cycle.
17. What causes evaporation?
O Air that is unsaturated with water vapor comes into contact with the surface of the water
O Air that is cooler than the water comes into contact with the surface of the water
O Air that is warmer than water comes into contact with the surface of the water
O Air that is supersaturated with water vapor comes into contact with the surface of the water in
Evaporation occurs when air that is warmer than water comes into contact with the water's surface, hence option A is correct.
What is evaporation?As a liquid transforms into a gas, evaporation, a sort of vaporization, occurs on the liquid's surface. For instance, a high concentration of the evaporating substance in the surrounding gas significantly slows down evaporation when humidity affects the rate of evaporation of water.
It takes in moisture from garden soil as well as the biggest lakes and seas, and the level of the water will decrease when it is heated by the sun.
Therefore, solar energy, or heat from the sun, is what causes the evaporation process to occur, hence option A is correct.
Learn more about evaporation, here:
https://brainly.com/question/5019199
#SPJ5
How can agriculture cause soil pollution?
Agriculture pollution
Explanation:
Agriculture is a main source of pollution in lake water. chemical and fertilzer
Answer:
Pesticides and fertilizers used on crops fed to animals are a major contributor to land pollution
Explanation:
hope this helps :)