Lebron has committed to a new workout plan at the beginning of January. He begins by doing 10 pushups on January 1 and will increase the number of pushups by 2 each day. How many pushups will he do on January 31? Show your calculations.​

Answers

Answer 1

Answer:

ok so if he starts by doing 10 and does 2 evrey day that means he will be doing 70 push ups on the last day of the month since

2*30+10=70


Related Questions


I need help on this please!

Answers

Answer: The correct answer is D, also for part B, do you need help with that one too?

Step-by-step explanation:

PLEASE HELPPPPPP FINDING CIRCUMFERENCE AND AREA OF A CIRCLE

Answers

Answer:

The circumference of the circle is 28.26 m.

The area of the circle is 63.585 [tex]m^{2}[/tex].

Step-by-step explanation:

To solve for the circumference of the circle, start by using the circumference formula of a circle, which is [tex]C= 2\pi r[/tex]. However, 3.14 will be used instead of [tex](\pi)[/tex] for this formula.

First, the radius of the circle needs to be found. To find the radius of the circle, divide the diameter by 2 because the radius equals half of the diameter. The radius is 9 m divided by 2, which equals 4.5 m.

Next, plug in the radius into the formula, and the formula will look like [tex]C=(2)(\pi )(4.5 m)[/tex]. Then, solve the equation, and the answer will be 28.26 m.

To solve for the area of the circle, start by using the area formula of a circle, which is [tex]A=\pi r^{2}[/tex]. However, 3.14 will be used instead of [tex](\pi)[/tex] for this formula.

For the area, plug the radius into the formula, and the formula will look like [tex]A= (3.14)(4.5m)^{2}[/tex]. Then, solve the equation, and the answer will be 63.585 [tex]m^{2}[/tex].

i want 2 equivalent fractions for 25/90 and for 106/300​

Answers

Answer:

25/90 there is 150/270 and 5/18

for 106/300 there is 53/150 and 212/600

Answer:

for 25/90 divide by 5 to get 5/18. For 106/30 divide both by 2 to get 53/150.

What is the resulting ordered pair if the value of the independent variable is -1?

f(x)= -5x - 4x +2
A. (-1, 1)
B. (-1, 11)
C. (2,-6)
D. (1, -1)

Answers

The answer is B if on Plato

Tanya has 130 ml of juice

Answers

Answer:

The answer is below

Step-by-step explanation:

A drink is made by adding water to juice.

Instructions

Add an amount of water that is between 3 times and 5 times the amount of juice

Tanya has 130 ml of juice.

If she follows the instructions, work out the minimum and maximum amounts

of the drink she can make.

Solution:

The minimum amount of water that can be added to the juice is 3 times the amount of the juice, hence:

Minimum amount of water = 3 * 130 ml of juice = 390 ml of water

Therefore minimum amount of drink = 390 ml of water + 130 ml of juice

minimum amount of drink = 520 ml

The maximum amount of water that can be added to the juice is 5 times the amount of the juice, hence:

Maximum amount of water = 5 * 130 ml of juice = 650 ml of water

Therefore maximum amount of drink = 650 ml of water + 130 ml of juice

Maximum amount of drink = 780 ml

Someone Help if they can ASAP!

Answers

Answer:

The answer is D.

Step-by-step explanation:

Since (4x+20) and 60 are vertically opposite angles. They both are equal. Hope this helped!

Brainliest goes to whoever answers correctly and explains also if you want extra points answer my other questions

Answers

Answer:

isn't that the same as before? :D

HELP i will give brainliest
all questions ;(

Answers

Answer:

1. The theoretical probability of rolling an even number and flipping heads is 25%.

2. The experimental probability of rolling a 1 and flipping tails is 15%.

3. The experimental probability of flipping heads is 40%.

4. I think around 7%.

5. I would expect to roll 3 and land on heads 8 times.

Step-by-step explanation:

I am not sure about number 4.

Have a nice day!

Ask me if you need my work. :-)

A rectangular room has an area of 12 m².the length of the room is 4m. what is the width of the room?​

Answers

Answer:

3

Step-by-step explanation:

area of rectangle = length × width

so the the given area is 12

area of rectangle is 12 = 4 × width

so when we multiply 4 × 3 we get 12

and the final answer is ...

area of rectangle = length × width

4× 3 = 12

HELP ITS 50points !

Answers

The answer is B) x = 2

Answer:

x=2

Step-by-step explanation:

9-10x=2x+1-8x

+10x +10x

9=2x+1+2x

9=4x+1

-1 -1

8=4x

÷4 ÷4

x=2

Whoever answers these 2 right gets brainliest and 25 points!

Answers

Answer:

1. C) 8•9

2. D) 4•2

Step-by-step explanation:

1. multiplication come first before division

2. You have to resolve parenthesis first (3+4•2)

3•24÷12-(3+8)

Answer:

i think c and d

Step-by-step explanation:

math

A rancher planned to fence 6 1/2 acres of land to grow some experimental grasses. After he had finished fencing 4 3/4
acres of the land, it started snowing. How many acres of the land remained to be fenced?

Answers

Answer:

1 3/4 acres

Step-by-step explanation:

6 1/2 - 4 3/4 = the remaining acres to be fenced.

we can bring all numbers to "quarters" (1/4th) to be able to make that subtraction.

6 1/2 = 13/2 = 26/4

4 3/4 = 19/4

so, 26/4 - 19/4 = 7/4 = 1 3/4 acres still to be fenced.

How will you calculate it's surface area?​

Answers

The general formula for the total surface area of a right prism is T. S. A. =ph+2B where p represents the perimeter of the base, h the height of the prism and B the area of the base.

I don’t know what to do?

Answers

Answer:

I geuss because the scale factor is 2 that the resulting triangle will be almost twice the size. Because in a dilation you multiply it. If you dont know how to dilate a triangle with a compass I would suggest looking for a video online. But I know for the part that says "Is the image of ABC similar to the original triangle" the answer would be yes it is similar because you are just dilating the triangle not changing its orientation. I hope this helps! Good luck!

The diagram shows a door lock.
B
2
3
4
The code is a letter followed by a number.
Write down all the possible codes,
write your answers like this: (A, 1)
You must write all of your answers on one line.

Answers

Dodidorikrekkrnrfnfkeieirididdiir

another question about angles

Answers

Answer:

ㄥBEC=70;ㄥABE=160

Step-by-step explanation:

(x-5)+(3x-5)+90=180

x-5+3x-5+90=180

4x+80=180

4x=100

x=25

ㄥBEC=3*25-5=70

ㄥABE=180-(25-5)=160

4x²+6X+9
Factorizar

Answers

4x2+6x+9

not factorable
So the common factor here is 2x to factorize

2x(2x+3)+9

That’s the only the factorization which is available so i hope this answers your question and with you the best!!

[tex]\frac{1}{3}x^{2} +5x+\frac{4}{3}=2x-\frac{1}{3} x^{2}[/tex]

Answers

x1= -4, x2= -1/2 is the correct answer

HELP PLEASE! for 20 points

Answers

Volume is base * height

Volume is hence 24 in * 6 in

Which gives you 144 in

Volume is 144in^3 (144 in cubed)


plsss helppp i have 1hr left

What is the value of x in the equation *x - y = 30, when y = 15?
O 4
8
O 80
O 200

Answers

Answer:

Is there an option of 45

Step-by-step explanation:

x-15=30

so +15

x=45

Người ta dự định chuyển 78452 lít dầu từ kho A sang kho B Trong 4 ngày đầu mỗi ngày chuyển được 18214 lít dầu hỏi còn phải chuyển bao nhiêu lít dầu nữa

Answers

Answer:

5596 liters  of oil still need to be transferred.

Step-by-step explanation:

Total oil = 78452 liters

oil transferred each day for 4 days = 18214 liters

The amount of oil transferred in 4 days = 4 x 18214 = 72856 liters

The mount of oil left in ware house A

= 78452 - 72856

= 5596 liters  

During math class, Laura stated that the two cylinders shown below have the same volume. Jean interrupted Laura and argued that the volumes of the two cylinders are different. Their
eacher explained that Laura was correct.

Answers

Answer:

3rd option

Step-by-step explanation:

Cavalieri's principle states that two figures which have the same height and  same cross-sectional area have the same volume

the height of the cylinders are both 42

the diameter of both figures is 24 as the diameter of the second cylinder = 12 x 2 = 24

the radius of the cylinders are both equal to 12

the diameter is the straight line that passes through the centre of a circle and touches the two edges of the circle.

A radius is half of the diameter

thus the volumes should be equal

Someone help I have been stuck on this for 30 min

Answers

Answer:

fcuck off nobdy caresd XD

Step-by-step explanation:

just give me brainliest, too poor to even be good at life LOL  JiEW

EDIT BCS YALL ARE GAEY A F

7. Which has the strongest correlation?
(1) r=0.7
(2) r = 0.1
(3) r=-0.75
(4) r=-0.99

Answers

Answer:

76yhgdttyhgfd

Step-by-step explanation:

nhjgklh/f

Thực hiện phép nhân, rút gọn rồi tính giá trị của biểu thức :
a) x(x - y) + y(x + y)
tại x = -6 và y = 8;
b) x(x - y) = x^(x + y) + yx2 – x) tại x =
1
và y = -100,
2

Answers

Answer:

i do not understand what youre asking

Step-by-step explanation:

see^^^^^

Which expression represents the algebraic phrase “nine times a number plus thirteen”?
9 minus y + 13
9 + y minus 13
9y + 13
13y + 9

Answers

Answer:

ok so its 9 times a number plus 13 this is shown as c

9y+13

Answer:

ok so its 9 times a number plus 13 this is shown as c

9y+13

Step-by-step explanation:

Question Progress
Homework Progress
31/ 127 Marks
There are between 24 and 40 students in a
class.
The ratio of boys to girls is 4:7
How many students are in the class?

Answers

Answer:

Step-by-step explanation:

The ratio of boys is 4/11

You need a number that is divisible by 11.

11 represents the number of students in the class. That was obtained by adding 4 and 7 together. So there are 4/11 boys and 7/11 girls.

You could try 33 which is between 24 and 40

4/11 * 33 = 12

There are twelve boys in the class.

7/11 * 33 = 21

There are 21 girls in the class.

21 + 12 = 33 which is exactly what you need.

Find the solution set of the inequality \qquad52- 3x < -14.52−3x<−14.52, minus, 3, x, is less than, minus, 14, point \qquad xxx

Answers

Answer:

x > 22

Step-by-step explanation:

Given the inequality;

52- 3x < -14

Subtract 52 from both sides

52 - 3x - 52 < -14 - 52

-3x < -14 - 52

-3x < -66

Divide both sides by -3

-3x/-3 < -66/-3

x > 22

Hence the required inequality is x > 22

[(-2)⁴ + 3.(3² - 1)]: [(-2)³ + 3.2² ]

Answers

Here is your answer, : )

A jeweler had a fixed amount of gold to make bracelets and necklaces. The
amount of gold in each bracelet is 6 grams and the amount of gold in each
necklace is 16 grams. The jeweler used 178 grams of gold and made 7 more
necklaces than bracelets. Write a system of equations that could be used to
determine the number of bracelets made and the number of necklaces made.
Define the variables that you use to write the system.

Answers

Let b = number of bracelets and n = number of necklaces

6b + 16n = 178 Weight of gold
n = b + 7 More necklaces than bracelets

Answer:

6b+16n=178

n=b+7

Step-by-step explanation:

Let b=the number of bracelets made

Let n=the number of necklaces made

System of Equations:

6b+16n=178

n=b+7

Other Questions
29 members in math club, treasury has $364 to spend, shirts are $11 caps are $14. How many caps and shirts can he buy to exhaust the funds available? Fill in the blank with the verb that best completes the sentence.Nosotros siempre _____ la verdad.* *la verdad = the truth decimosasistimosvenimosdormimos Otto invests $ 600 in an account that pays 7.3 % interest compounded annually. How much is in Otto's account after 3 years What is the definition of 'gist'?The facts used by the author to make a point.The main point or essence.The transitions between paragraphs.The conclusion of an article A rental car company charges $80 per day to rent a car and $0.10 for every mile driven. Alyssa wants to rent a car, knowing that: She plans to drive 150 miles. She has at most $300 to spend. Which inequality can be used to determine xx, the maximum number of days Alyssa can afford to rent for while staying within her budget?Geq30080x+15300 15x+80\leq30015x+80300 80x+15\leq30080x+15300 15x+80\geq30015x+80300 Consider Hermia's first words when she enters the scene. How do her comments about the setting relate to the action of the scene? In particular, how might Shakespeare intend a double meaning here for her use of the word "sense"? A woman sold an article for 20.00cedis and made a profit of 25%.Find the cost price of the article. What is the sign of -9. (0/-3) If a firm's marginal tax rate is increased, this would, other things held constant, lower the cost of debt used to calculate its WACC. True False When evaluated, which expression has a result that is a rational number? How does convection cause ocean currents?A. During the process of convection, energy is transferred to the atmosphere forming winds. These winds power surface currents.B. During the process of convection, the heating of surface water by the sun results in upwelling.C. During the process of convection, energy in warm water is lost to its surroundings. The water cools, becomes denser, and sinks.D. During the process of convection, more minerals and gases dissolve in warm water. This increases the density of the warm water and causes it to sink. The angle of elevation to a nearby tree from a point on the ground is measured to be31. How tall is the tree if the point on the ground is 62 feet from the tree? Roundyour answer to the nearest tenth of a foot if necessary. Lighting is the movement of? A business manager finds that the building expense each month is completely uncorrelated with revenue levels. What should the business manager assume about this cost? What is 100 5 4 + 43 A. 69B. 144C. 0.3D. 1.2 HELP 18 POINTSJournal prompt to be answered in 2 fully developed paragraphsPrompt: How does physical activity prevent disease and reduce health care costs? Use specific examples from your experience. how can an irreverible step in a metabolic pathway be reversed?A. When both the reactants and products have equal amounts of energyB. When the reactants contain large amounts of energyC. When another chemical reaction with a large amount of energy occurs at same time D. when collision of substances generate the energy neededhow can an irreverible step in a metabolic pathway be reversed?A. When both the reactants and products have equal amounts of energyB. When the reactants contain large amounts of energyC. When another chemical reaction with a large amount of energy occurs at same time D. when collision of substances generate the energy neededOrder the sequence of events in transcription?1- free ribonuleotide triphosphates base-pair with the deoxyribonucleotides in the DNA template 2- RNA polymerase binds to the promoter region of a gene3- primary rna transcript is formed 4- two DNA strands are seperatedWhich organic molecule is not found on the plasma membrane?A. carbohydratesB. cholestrolc. phospholipidsd. proteinsWhat does this statement mean : "Information flow between cells tissues and organs is an essential feature of homeostasis and allows for integration of physiological processes"A. the nervous system is the most prominent body system for integration of physilogical processes B. some substances can affect local processes while others travel to exert their effects on other distant parts of the bodyC. communication between body structures through body fluids is the most important physiological processesD. Neurotransmitters, hormones, paracrine and autocrine substances exert their efferts locally as well as distant body structureswhich statement best describes the orientation the phospholipid molecules in a membrane:A.) the nonpolar fatty acids are oriented towards the cholestrol moleculesB.) the hydrophilic layer is oriented towards the middle of the phosphlipids C.) phospholipids align themselves in the membrane in a bimolecular layerD.) the hydrophobic and hydrophilic structures point away from the cellWhich is NOT a product of glycolysis under aerobic and anaerobic conditions?A.) lactate B.) FADH C.) pyruvate D.) NADH Which reason is why water is an essential nutrient? A.) water needs to move between compartmentsB.)can be obtained through ingestionC.) body cant make enough water for its needsD.) water evaporates from the skin that has the largest surface area among all body structures From the top of the leaning tower of Pisa, a steel ball is thrown vertically downwards with a speed of 3.00 m/s. if the height of the tower is 200 m, how long will it take for the ball to hit the ground? Ignore air resistance. Suppose that the speeds of cars travelling on California freeways are normally distributed with a mean of miles/hour. The highway patrol's policy is to issue tickets for cars with speeds exceeding miles/hour. The records show that exactly of the speeds exceed this limit. Find the standard deviation of the speeds of cars travelling on California freeways. Carry your intermediate computations to at least four decimal places. Round your answer to at least one decimal place. Express this sense sequence as a polypeptide. Use the three letter abbreviation and separate the amino acids with a dash - e.g. Trp-Thr-Ala. If there is a stop codon - you may add an asterisk to the sequence - e.g. Trp-Thr-Ala-* ATTTTAGCCATGCCCGGGAAAATACGCCGCCCTCCCGGTACACCATTGTTCGGCAAATAAAAATAAAAT polypeptide sequence [answer1] what is the DNA sequence of the 5' UTR? [answer2] what is the RNA sequence of the 3' UTR [answer3]