Answer:
Its C, They can use reliable web sites or books.
Explanation:
A red flower producing snapdragon plant is crossed with a white flower producing snapgragon plant. Resulting F1 generation is crossed with one another to produce F2 generation.
This is incomplete dominance of genes.
Q1 What type of a breeding is this? (monohybrid, dihybrid or interspecific)
Q2 Draw a genetic chart to show P, F1 and F2 generations clearly indicating genotypes, phenotypes and generations.
Answer:
See the answer below
Explanation:
1. This is an example of monohybrid breeding. A monohybrid breeding is the type of breeding that involves parents with a pair of contrasting characters. On the other hand, a type of breeding involving a single gene is what is known as monohybrid breeding.
2. When a red flower snapdragon is crossed with a white flower snapdragon, the resulting offspring are usually pink - an indication of incomplete dominance of the gene responsible for flower color. Assuming the red flower's genotype is AA and that of the white flower is aa:
AA x aa
Aa Aa Aa Aa
F1 genotype = all Aa
F1 phenotype = pink flower
At F2:
Aa x Aa
AA 2Aa aa
F2 Genotype/phenotype:
1AA - red color
2Aa - pink flower color
1 aa - white flower color.
Why do you think premenopausal women need more iron than
men of the same age?
Answer:
Women need more iron than men to make up for the amount of iron they lose in their menstrual period.
Explanation:
Answer:
Premenopausal women shed blood as part of menstruation every month, which lowers the level of iron in the body. So, they need more iron than men and are also at a greater risk for this nutritional deficiency.
PLATO
Explanation:
Under normal conditions glomerular filtration depends on three main pressures. What pressures is a pressure that favors the process of filtration?
Answer:
Glomerular Hydrostatic pressure .
Explanation:
The basic function of the kidney is the formation of urine for elimination through the urinary excretory system. Two different processes determine this formation: the filtration of fluid through the glomerular capillaries into Bowman's space and the modification of the volume and composition of the glomerular filtrate in the renal tubules. The fluid passes from the glomerular capillaries to Bowman's capsule due to the existence of a pressure gradient between these two areas. This process is favored by two structural characteristics that make renal corpuscles particularly effective filtration membranes: glomerular capillaries have a much higher number of pores than other capillaries, and the efferent arteriole has a smaller diameter than the afferent arteriole, causing greater resistance to outflow of blood flow from the glomerulus and increasing glomerular hydrostatic pressure. Increased glomerular hydrostatic pressure (due to increased blood flow through the glomerulus) increases filtration, while increases in Bowman's hydrostatic pressure or urinary space (which remains constant, unless there is disease at that level, usually due to fibrosis) and plasma P. oncotic (determined by proteins, which tend to "drag" plasma into the glomerulus) decrease filtering. Resulting in a filtering pressure of 10 mmHg.
Which of the following groups gets energy directly from the grass it eats?
Answer:
herbivores
Explanation:
i think it's herbivores because "herb"ivores get energy when eating grass or any other herb.
what are biogeochemical ?
Which is incorrect descriptions of the genetic event initiated by the HIV reverse transcriptase (RT) upon the HIV infection?
a. RT catalyzes initial synthesis of ssDNA using viral genomic RNA as the template.
b. The first RNA template is degraded after ssDNA synthesis.
c. The whole process is completed after synthesis of dsDNA.
d. tRNAs are adopted as the first primers.
e. None of these
Answer:
e. None of these
Explanation:
The immune deficiency viruses (HIV) are retroviruses that use a reverse transcriptase (RT) enzyme to produce a single-stranded DNA (ssDNA) from an RNA template. The reverse transcription allows retroviruses to replicate their genetic material, which is integrated into the host's genome as a double-stranded linear DNA molecule in a similar way to the mechanism of insertion used by endogenous retrotransposons. The synthesis of DNA is started by cellular tRNAs (tRNA3Lys) that are packaged into the virion. After reverse transcription, the HIV DNA enters the nucleus of CD4 immune cells (also known as CD4+ T cells), and then it integrates into the genome to coopt the host's cell machinery for its own replication.
Which is a feature of a tonic receptor? Select one: a. The action potential occurs when there is a change in response to a change in condition. b. For this receptor, the stimulus begins with a burst of action potentials. c. They are normally inactive. d. When the stimulus changes the action potential generation changes. e. Provides information about the rate and change of the stimulus. f. The action potential is generated for a short time period.
Answer:
For this receptor, the stimulus begins with an explosion of action potentials.
that would be the correct option.
Explanation:
A tonic receptor is one that is activated when the action potentials were maintained over time and during the signaling of the receptor.
Tone receptors require continuous stimulation over a period of time to trigger a response and deliver it to the central nervous system.
It keeps the nervous system constantly active in the environment that surrounds it.
They are slowly adaptable, an example of these receptors are the merkel and ruffini receptors.
A purebred tall pea plant is cross-pollinated with a tall, heterozygous pea plant. Use a Punnett square to determine the probability the offspring inherita
recessive short allele. (I point)
75%
25%
0%
50%
Answer:
0%
Explanation:
This question involves a gene coding for height in pea plants. The allele for tallness (T) is dominant over the allele for shortness (t). This means that allele T will be expressed over allele t in an heterozygous state.
A purebred tall plant will possess genotype: TT while a heterozygous tall plant will possess genotype: Tt. The two parents will produce the following gametes:
TT- T and T
Tt- T and t
Using these gametes in a punnet square (see attached image), the following offsprings with genotypes: TT and Tt in a ratio 1:1 will be produced.
TT offsprings are purebreed tall while Tt offsprings are heterozygous tall. Hence, based on the question, no offsprings of this cross will possess the recessive genotype (tt). This means that 0% of the offsprings of this cross will be short.
which type of soil is likely to be found in horizon E
Answer:
A layer of pale,Sandy soil lacking clay and iron is likely to be found in horizon E
Answer:
bedrock
Explanation: A layer or bedrock is the type of soil is likely to be found in horizon E. Hence the correct answer is option A among the options. The bed rocks can be regarded very hard and it cannot be breakable.
Without this, many cycles such as the water cycle and photosynthesis would not exist. What could all these cycles not exist without?
Answer:
This question appears incomplete
Explanation:
This question appears incomplete. However, one similar substance that, if missing, many cycles (particularly the two cycles/processes provided in the question) will not exist/proceed is the sun/sunlight.
In the water cycle for instance, if there is no sun/sunlight, there will be no heat to allow for evaporation of water from the water-body (ocean, sea, stream or lake) hence there will be no cloud of water droplets in the atmosphere. The implication of this is that, the first process of the water cycle will not proceed, hence the cycle will not exist.
During photosynthesis, carbondioxide reacts with water in the presence of sun/sunlight to produce glucose and oxygen. The absence of sun in this reaction will not lead to the production of glucose which is the useful product of photosynthesis for plant.
From the explanation above, it can be deduced that the absence of the sun/sunlight will prevent the two cycles from existing.
C. If you combined the elements in the product of this reaction, what type of
reaction would it be? Hint: What is the reverse of the equation you just
balanced? (1 point)
Answer:
Reversible reaction
Explanation:
If the elements of the product combine together in a chemical reaction, this reaction is called reversible reaction because the reaction moves in backward or reverse direction. For example, if acid i. e. HCl combine with base i. e. NaOH which are the reactants, it produces two products salt (NaCl) and water (H2O). If salt (NaCl) and water (H2O) combine again with each other, it produces acid i. e. HCl and base i. e. NaOH, such type of reaction is called reversible reaction.
Which location is least likely to experience a volcanic eruption? Α. an island hot spot, such as the island of Hawaii B. Hamilton County on the plains of central Texas с. a convergent boundary, as in the Ring of Fire D a volcanic island arc, such as the Aleutian Arc in Alaska
Answer:
i think that the answer is B. Hamilton County on the plains of central Texas i took the test
Explanation:
Hamilton County on the plains of central Texas is least likely to experience a volcanic eruption. Therefore, option (B) is correct.
What are volcanoes?Molten rock and gases stored under the surface erupt through a volcano, generating a hill or mountain.
Active, inactive, or extinct volcanoes. Active volcanoes are likely to erupt again. Dormant volcanoes may erupt again. Extinct volcanoes won't erupt.Magma collects inside active volcanoes. The magma chamber's pressure forces it through rock channels and onto the planet's surface.
Volcanic eruptions can be violent or slow-moving. Volcanoes erupt through vents on the sides or a primary entrance at the top. The volcano's morphology depends on eruption rate and magma chemistry. Land and sea volcanoes exist. As lava cools and hardens, underwater volcanoes build mountains and ranges. When volcanoes rise above the ocean, they create islands.
Learn more about volcano, here:
https://brainly.com/question/18058649
#SPJ5
what type of molecule do plant cells use for long term energy storage
Answer:
ATP
Explanation:
In plants, energy is stored in the form of ATP and NADPH. Energy is produced in the presence of light it is in the thylakoids and mitochondria.
ATP: Adenosine triphosphate
NADPH: nicotinamide adenine dinucleotide phosphate hydrogen
Which of the following properties is the temperature at which a liquid turns to gas? (3 points)
оа
Magnetism
Ob
Thermal conductivity
ос
Melting point
Boiling point
Od
thermal conductivity
Answer:
Boiling point
Explanation:
I did the test
What is the wavelength of an earthquake wave if it has a speed of 10 KM/S and a frequency of 5HZ?
Answer:
2nm
Explanation:
(10KM/S)/(5HZ) = 2nm
"Acidic" is an appropriate description for four of the following. Which one is the exception?
A). Soup and ammonia
B). HCI
C). Excess hydrogen ions
D). The contents of the stomach
E). A pH less then 7
Answer:
E) A pH less than 7
Explanation:
if a solution has a higher concentration of hydronium ions than pure water , it has a pH lower than 7
Answer: e
Explanation:
I did the test
What cell feature is used by scientists to classify an unknown cell as prokaryotic or eukaryotic?
Answer:
Like a prokaryotic cell, a eukaryotic cell has a plasma membrane, cytoplasm, and ribosomes, but a eukaryotic cell is typically larger than a prokaryotic cell, has a true nucleus (meaning its DNA is surrounded by a membrane), and has other membrane-bound organelles that allow for compartmentalization of functions.
Explanation:
Hope this helps ;)
Question 3 (1 point)
During DNA replication, one of the new strands of DNA is synthesized continuously.
The other strand is synthesized as a number of separate fragments of DNA that are
subsequently linked by DNA ligase. Why does this occur?
- RNA primers only anneal to one of the parental strands of DNA.
- DNA polymerase III only synthesizes DNA in the 3' - 5' direction.
- DNA polymerase III only synthesizes DNA in the 5'-3' direction.
- One of the parental strands is unwound slower than the other by helicase.
Answer:
DNA polymerase III only synthesizes DNA in the 5'-3' direction.
Explanation:
DNA replication is an important phenomenon for every living cell. It is the process whereby the double-stranded DNA is doubled to form two new separate double strands. In order for DNA replication to occur, the double strand of the DNA molecule must first be unwound by an enzyme called DNA HELICASE. This gives two separate single strands, which individually acts as a template for the newly synthesized strands.
DNA polymerase III is the enzyme responsible for synthesizing new DNA strand by pairing complementary nucleotides to the old strands it attaches to. However, one of the old strands called LEADING STRAND runs in the 3'-5' direction while the other strand called LAGGING STRAND runs in the 5'-3' direction.
DNA polymerase III only attaches to the 3' hydroxyll end of the DNA and synthesizes new strand of DNA in the 5'-3' direction. Since the lagging strand runs in 5'-3', it is synthesized in small separate fragments called OKAZAKI FRAGMENTS which are later joined together by an enzyme called LIGASE.
N.B: As DNA polymerase synthesizes DNA strand on the leading strand(5'-3'), it is moving in an opposite direction of the lagging strand. Hence, it has to detach and come back to synthesize on the lagging strand. This causes the lagging strand to be synthesized discontinuously.
According to kirk smith a professor of environmental health at the university of california berkley indoor fires increase risks of pneumonia tuberculosis lung cancer and low birth weight in babies born of women expose during pregnancy. What simple solution is being widely promoted to reduce the risk of death?
a) preparing meals using solar cookers.
b) switching from wood to burning crop waste as a fuel source.
c) adding more windows to houses as a source of ventilation.
d) passing a green tax to make homeowners pay for their pollution.
e) providing asthma inhalers to children under the age of 12 years.
Answer:
preparing meals using solar cookers.
Explanation:
solar cookers radiates at low rates.Therefore the most of the nutrients in the foods are conserved.Thus most micro nutrients for biochemical activities are retained. Vitamins which can not withstand high temperature are preserved.
Most importantly carcinogens which are usually associated with high heat foods are avoided ,when cook with low heat of solar cookers
The solar cooker is smoke free,therefore irritation of the lungs,lung cancer associated with high heat cookers is avoided.
Specifically,local Mayan women exposed to high heat smoke cookers, suffers lung cancer,and those with pregnancy gives to infants with low birth weights. Children exposed to theses high heat also experienced acute lower respiratory infections.
Thus the smokeless,low heat solar cooker is safer.
Which of the following is NOT a factor of sustainability?
Group of answer choices
economics
ethics
biodiversity
natural capital
solar energy
Answer:
natural capital
HOPE IT HELPS!
PLS MARK AS BRAINLIEST!!!
what is sexual reproduction
Answer:
See explanation below...
Explanation:
Sexual reproduction is a type of reproduction that involves a complex life cycle in which a gamete with a single set of chromosomes combines with another to produce an organism composed of cells with two sets of chromosomes.
Best Regards!
Answer:
the production of new living organisms by combining genetic information from two individuals of different types (sexes). In most higher organisms, one sex (male) produces a small motile gamete which travels to fuse with a larger stationary gamete produced by the other (female).
The medical term ____________________ describes a pus-filled lesion on the eyelid resulting from an infection in a sebaceous gland.
Answer:
the medical term is hordeolum
whats the biggest mystery about the virus
Explanation:
Hey, there!!
According to what i have learned, the biggest mystery about virus is; It acts like both living and non- living beings.
living characters includes :
It reproduce to make more no. of themselves. It feeds on various substances.non- living characters:
It can be crystallize. It dont respire and feed eith it is out from a host body.Hope it helps...
Choose the PCR primer pair that will amplify the breakpoint of a deletion of the segment of DNA between lines 1and 2.
5' TCGATTCCGGAAAGCTTAGTTTCCCGGGACGTATTGCCAACCTAGGTAAGCGCCGAATATCCATGGGCACC 3'
3' AGCTAAGGCCTTTCGAATCAAAGGGCCCTGCATAACGGTTGGATCCATTCGCGGCATTATAGGTACCCGTGG 5'
a. 5- AGCTAAGGCCTTTCGA and 5'-CCACGGGTACCTATAA
b. 5'- TCGATTCCGGAAAGCT and 5'-ACGTCCCGGGAAACTA
c. 5- TCGATTCCGGAAAGCT and 5'-CCACGGGTACCTATAA
d. 5'- TCGATTCCGGAAAGCT and 5'- GGTGCCCATGGATATT
e. 5' - GGTGCCCATGGATATT and 5' ACCTAGGTAAGCGCCG
Answer:
a. 5- AGCTAAGGCCTTTCGA and 5'-CCACGGGTACCTATAA
Explanation:
The Polymerase Chain Reaction (PCR) primers are short nucleotide sequences (composed of approximately 20 nucleotides in size) flanking a target sequence that is amplified during PCR reaction. These primers bind to the DNA template by means of complementary base pairing in order to make billions of copies of a target DNA region, which is then visualized as a band by electrophoresis. In this case, PCR primers from the item a- (i.e., AGCTAAGGCCTTTCGA and CCACGGGTACCTATAA) will bind to the DNA template of lines 1 and 2 in order to amplify a continuous region:
Schematically:
The Foward primer AGCTAAGGCCTTTCGA binds by complementary base pairing:
5'_(TCGATTCCGGAAAGCT)TAGTTTCCCGGGACGTATTGCCAACCTAGGTAAGCGCCGAATATCCATGGGCACC_3'
The Reverse primer CCACGGGTACCTATAA binds by reverse complementary base pairing:
3'_AGCTAAGGCCTTTCGAATCAAAGGGCCCTGCATAACGGTTGGATCCATTCGCGGCA(TTATAGGTACCCGTGG)_5'
The levels of nitrogen and ___ in the atmosphere remain fairly constant but the levels of other gases may vary.
Answer:Oxygen
Explanation:
As a substance is eaten, trace its path through the digestive system. Include one of the basic processes each step of the way: digestion, absorption, motility, secretion, and excretion.
Answer:
....... motility
Explanation:
which particles is the fundamental unit of all matter in both living and nonliving
Answer:
atoms
Explanation:
all things in the universe are made of atoms and they are considered the fundamental unit of matter.
non-living things are composed of different compounds and molecules.
living things are made of cells, and cells themselves are made of different molecules. So living things are also made of atoms.
If tall is dominant over short, and yellow seed is dominant over green, how would you write the genotype of a pea plant that is heterozygous for tall, and that produces yellow seeds
Answer:
The answer has been written in paper and the image of the paper has been attached. Feel free to raise any doubt.
1. A star is 520 light years from Earth. During what event in history did the
light now arriving at Earth leave the star?
Answer:
A light year is the distance which is equal to 9,460,730,472,580.8 km, so:
= 4.91957985 X [tex]10^{15}[/tex]km
which is distance travels by the light. Now what time it takes light to travel distance we found.
A year has 365.25 days, so,
[tex]1 (\frac{365.25)}{1 year}) (\frac{24}{1 day}) (\frac{3600 s}{1 hr} )[/tex] = 31557600 seg/year
The light speed in the space is equal to 299,792.458 km/s, so:
4.91957985 x [tex]10^{15} (\frac{1 seg}{29792.458}) \frac{1 year}{31557600}[/tex] = 520 years
if today, August, 2020, then
2020 - 520 = 1500
Spanish and Portuguese spread out over the southern part of the Western Hemisphere and bring in America brought to Spanish colony of Santo Domingo in year 1500.
[tex]t=2019-520\\ t=1499 AD[/tex]
Learn More:https://brainly.com/question/8244352
if a short sequence of dna reads 3'TAACGTCCAGGCAAA5', what is the complementary sequence in the other strand of dna g
Answer:
5' ATTGCAGGTCCGTTT 3'
Explanation:
Complimentary strands of DNA run anti-parallel to each other, the ends facing in opposite directions.
The complimentary base pairs for DNA are:
A=T and C=G and when finding the complimentary strand these pairs are only paired with each other.
