Match the sentence to the part of the paragraph it represents.

Match The Sentence To The Part Of The Paragraph It Represents.

Answers

Answer 1

Answer: From top to bottom: evidence, commentary, and claim

Explanation:

Answer 2

The first sentence to the part represents evidence. The second sentence to the part represents commentary. The Third sentence to the part represents the claim.

What is Evidence?

Evidence refers to  something that provides proof or points toward a conclusion. It is also used in the courts to justify the person fighting against the other in order to prove his or her innocence.

Comparing the owner's pet serves as proof because a cat near the rocking chair can be concerned about getting its tail injured.

When the sheriff opens the door, the tavern owner looked like a long tail cat rocking on the chairs, represents the commentary.

Therefore, it can be concluded that The part's opening statement serves as proof. The second paragraph's second sentence is commentary. The assertion is made in the third sentence of the part.

Learn more about Evidence here:

https://brainly.com/question/15880833

#SPJ5


Related Questions

9 people are playing a modded game
there trying to see who is imposter

hardcore among us modded
mods: jester, detective, sherif, imposter can morph, 1 hint, imposter can do task.
hint: jester is not pink or black sherif is blue

a. blue said look ant mi and die mi gun kill ya'll imposters
b. black said i dont have any visual task
c. pink said orange is imposter without proof
d. orange said i saw jester/imposter near a body (but he diddint)
e. purple said pink is safe she did scan.
f. white said wait imposter can do task when i saw teals body blues footprints was all over it
g. blue said wai- wh- hu- hang o-
h. green said wait morph imposter can morph
i. brown said how do you know....

Answers

Question:

Nine people are playing a Among Us mod

they are trying to find out who the Imposter  is

This is a hardcore Among Us mod

Mods: Jester, Detective, Sheriff, the Imposters can morph, a hint, and the Imposters can do tasks.

Hint: The Jester is not Pink nor Black and the Sheriff is Blue

Answers to choose from:

a. blue said look at me and die my gun will kill you imposters

b. black said I don't have any visual task

c. pink said orange is imposter without proof

d. orange said I saw jester/imposter near a body (but he didn't)

e. purple said pink is safe she did scan.

f. white said wait imposter can do task when I saw teals body blues footprints was all over it

g. blue said wai- wh- hu- hang o-

h. green said wait morph imposter can morph

I. brown said how do you know....

 

People who could be the Imposter: brown, orange, and white

People who are not Imposters: black, green, pink, and blue

Purple: ???????

Answer:

Orange, Brown or White could be the Imposters.

White is the letter f,

Brown is the letter I,

and Orange is the letter d.

Explanation:

Brown - who would say how did you know that. That is kind of telling us he could be or is the Imposter.

Purple - We don't know to much about Purple. Purple could be the Jester or the Imposter or a Crewmate. We would need more information to specify who Purple is. Pink is safe and she did the scan.

White - White said "wait imposters can do task then how come I saw Blues footprints on one of them." It says that the Imposters Can Do Tasks. This information is telling us that White could be or is the Imposter.

Orange - Orange said that he saw the jester/imposter near a body, but he didn't specify what color it was, if he actually did see the someone near a body he would have known what color the killer was. He would also have told the others (unless he was the Imposter).

Blue - Blue said "look at me and die my gun will kill you imposters

." Blue is the Sheriff because only the Sheriff's will have a gun but the Imposters will have a knife.

Pink - Purple said she saw Pink do the MedBay Scan, but did Pink see Purple, I don't know and we will never know because we don't have that information. Pink said orange was the Imposter without any proof.

Black - Black is the Detective because they don't have visual tasks.

Green - Green said "wait morph imposter can morph.

" That is telling you that he did not know Imposters could morph, so that means he is not one of the Imposters.

My Questions:

Is the Jester the same thing as the Imposter?

Can there be more than one Imposter?

Is there anything we are missing?

Is there anything to help us find out who the Imposter is?

How many Imposters are there?

The excerpt below is what type of paragraph?
As pets, cats can be very trying. They seem to need very
little attention and so often seem aloof and arrogant. They
are unpredictable and can turn on you with their teeth and
claws in the middle of playing. Cleaning a cat's litter box is
also a problem, as it is a smelly process and
unmanageable for some people.
A. Topical
B. Comparison
C. Transitional
D. Process

Answers

Answer:

A. Topical

Explanation:

According to the given excerpt, the paragraph talks about cats and their behavior, how they are unpredictable and can turn on one even when playing and how their litter is smelly.

The excerpt is a type of topical paragraph. This is because a topical paragraph has a well developed main idea or theme of which cats were the main idea in this one.

Tragedy has happened today. Is written as an active or passive voice ?

Answers

Active voice( gotta put more things or it won’t answer)

But no sooner had he said this than the wind began to roar like a dragon. The sail filled with air and yanked the boat on its side until Denzo released the line. Freed, the sail whipped about, flapping like a wounded bird. Toraemon grabbed the oars and pulled, while Jusuke tried to lower the sail.

How does the author make this part of the story exciting?

She uses strong action words.
She develops a slow pace.
She uses strong adjectives.
She develops Denzo’s character.

Answers

Answer:

The correct answer is A., or "She uses strong action words."

Answer:

A "she uses strong action words"

Explanation:

Write a letter to a friend saying how much they mean to you max 3 paragraphs
(best letter will get brainliest) 25 points

Answers

To,
Aliciaparker045

Date -8th jan 2021

It was a blessing the day you came to my life. At first i thought you will just be a casual friend to me in my life. but as we spent quality time together i realised that you are a special one to me.

I know we don't talk much as i am an introvert by nature. but when i talk to you once in a while. i feel mesmerized. i feel very amusing in my life. I still sometimes remember the crazy things we did in our life. I still remember that day when you helped me to conquer my nervousness while i was trying to gift her the sketch i made for her that day. hell it was scary at first but later on that day, i may had sucked that day at expresssing it but i feel really nice when i spend those times with you. I know we are graduated & soon we may part ways later on in our life, but we will always be connected through the memories we created in our heart. I even know we haven't had much selfies & all that in our life coz we both didn't liked it much but that's doesn't mean we will forget each other. I will always remember you.

Always remember we are brother's in arms, Brothers in feud.etc. & i will always be there for you even if the world isn't gonna be. I will always be the person to support you when it comes about the important life decisions you are hesitanting for. Go ahead, aim for the better future so that you may be able to create a paradise for the one you want to spend you rest of you life with.Make a fortune. Don't rely on luck. a real man makes his own luck. A real men does not wait for the opportunities to occur. he creates one. Set yourself some ambitions which will be beneficial to you. Ask me anything when you are in doubt. I may not be able to give you a satisfying solution for it but i will try my best. Our life is going to be enough harder from now on. but we will stood up again.

Take care,

Lovingly ,
Nightmare866
(real name - Amélie lee)

Why do you think mirrors were “rare”? Provide evidence (quotes from the text) to support your answer.

Answers

Ok ruzhzxurxfgk if if ufufxuxueze

how would you describe the relationship between pow wows and family?

Answers

Answer:

Exhausting

Explanation:

Read this excerpt from ameliaearhart.com regarding pilot Amelia Earhart: In 1937, as Earhart neared her 40th birthday, she was ready for a monumental, and final, challenge: she wanted to be the first woman to fly around the world. Which option correctly uses ellipses to quote the excerpt? 0 A. According to the website AmeliaEarhart.com In 1937,... she was ready for a monumental and final, challenge: she wanted to be the first woman to fly around the world. 0 B. According to the website Amelia Earhart.com, "In 1937. she wanted to be the first woman to fly around the world. OC. According to the website AmeliaEarhart.com, "as Earhart neared her 40th birthday, she was ready for a monumental, and final, challenge. O D. According to the website AmeliaEarhart.com, she was ready for a monumental, and final, challenge: she wanted to be the first woman to fly around the world​

Answers

Answer:A

Explanation:took the test

The statement that best describes the Health Science cluster is Health Science careers determine the cause of medical issues, provide treatment, and schedule appointments.

What are the benefits of Health Science careers?

Health Science careers include helping people who enter doctor's offices and hospitals, but do not include helping pets.Health Science careers determine the cause of medical issues, provide treatment, and schedule appointments.

Health Science careers are run by private business that help people without making a profit. Health Science careers are nonprofit organizations, which means they receive money from taxes.

Therefore, The statement that best describes the Health Science cluster is Health Science careers determine the cause of medical issues, provide treatment, and schedule appointments.

Learn more about Science careers on:

https://brainly.com/question/9170867

#SPJ5

Whats the answer please

Answers

Answer:

i answered that awhile back i think it was d

Explanation:

Drag each tile to the correct box.
Match each word or phrase from the passage with the statement that best explains how It reflects the setting of the text.
(A)This phrase reflects the setting's weather conditions.
(B)This phrase reflects the setting's lack of necessities.
(C)This phrase reflects the setting's landscape.
(1) " We're starving!"
(2)"Men on horseback rode up."
(3)"shouting and sweating"

Answers

Answer:

(1) " We're starving!" - (B)This phrase reflects the setting's lack of necessities.

(2)"Men on horseback rode up." - (C)This phrase reflects the setting's landscape.

(3)"shouting and sweating" - (A)This phrase reflects the setting's weather conditions.

Explanation:

One: If someone is starving, that usually means there is no food nearby, or they would have eaten already.

Two: You can't ride horses just anywhere.

Three: "Sweating" implies that the weather was hot.

(1) We're starving - (B)This phrase reflects the setting's lack of necessities, (2)Men on horseback rode up.- (C)This phrase reflects the setting's landscape, (3)shouting and sweating - (A)This phrase reflects the setting's weather conditions.

What is weather conditions?

Weather conditions are the different typers of weather changes, there are commonly six types of weather change occur in the atmosphere they are temperature, atmospheric pressure, wind, humidity, precipitation, and cloudiness.

Showers that are isolated and cover less than 15% of a region. A line of a constant meteorological value is called an ISOPLETH. A line of constant wind speed is an isopach.

Thus, the sentence are matched above.

For more details about Weather conditions, click here:

https://brainly.com/question/17768786

#SPJ5

Mrs. Stroud believes that Mr. Brooks won't sign over rights to Jupiter because... orbiting jupiter is the book

A.he wants to adopt her himself.


B.he wants money from Madeleine's parents.


C.he knows that Joseph wants to see her.


D.he thinks Madeleine's parents should adopt her.

Answers

Answer:

B.

Explanation:

where is the heart located

Answers

Answer:

the heart is in the front and middle of your cheats

Answer:

Up the as.s throught the small intensity to the large into the kidney up in your stomach, up the esophagus take a huge left to your left lung and down your air tubes through some blood veins and theres your heart :)

Which character trait do the others find offensive? Support your answer with at least two examples from the text. From the story " the cat walked by himself".

Answers

Answer:

The other animals thought that the cat was arrogant, superior and possessed a petulant independence.

Explanation:

"The cat walked by himself" tells the story of how human beings domesticated all animals, but he had trouble taming the cat that refused to submit to human wishes. The cat was also not very popular with the other animals, who were offended by the cat's behavior, who were always very arrogant, with an air of superiority and petulance.

How do the words clapping and stomping in the poem "Latin & Soul" convey the speaker's feelings about the music? They demonstrate that the speaker dislikes how music affects people. They suggest that the speaker feels like the music is inappropriate. They reveal that the speaker feels that the beat of the music is harsh. They show that the speaker feels the music is lively and brings people together.

Answers

Answer:

They show that the speaker feels the music is lively and brings people together

Explanation:

I just did the quiz and got it right

The words clapping and stomping in the poem "Latin & Soul" convey the speaker's feelings about the music as hey show that the speaker feels the music is lively and brings people together. Thus the last option is correct.

What is the central idea of the poem "Latin & Soul"?

The poem "Latin & Soul" describes the central idea of the power of music. It tells the reader how music enhances one's understanding and helps to bring change in the mood of someone.

The words clapping and stomping reflect together like when a  person joins his hands in order to perform the activity so with the use of these words, the speaker feels the music is lively and brings people together.

This entails the enthusiasm and excitement created by the music which brings people together to share their joy and happiness and makes them closer to sharing their emotions with one another.

Therefore, the last option is appropriate.

Learn more about "Latin & Soul", here:

https://brainly.com/question/18342028

#SPJ6

The plot stage that describes Miss Fairchild is

the

A. exposition

B. conflict

C. climax

D. resolution

Answers

B. Conflict is the answer

Romeo and Juliet Act 5. I will give brainliest

What is your first reaction to the S u i c i d e s of Romeo and Juliet? Do they act nobly or cowardly in choosing S u i c i d e Consider other actions they might have chosen? Do you think Shakespeare glorifies or condemns S u i c i d e in the play? Write your opinion and support it with details from the play.

Answers

Answer:

I think it's very noble that they chose to give their lives for what they thought was right.

Explanation:

Please mark brainliest

Answer:

In the play Romeo and Juliet they choose S u i c i d e

They acted very cowardly.

 Both had a life ahead of them and they desided to do S u i c i d e

a friend of Romeo’s, brings him news that Juliet is d e a d and lies in the Capulet tomb. Resolved to find her and join her in death, Romeo first visits an apothecary and bribes him to obtain an i l l e g a l (and l e t a l) p o i s o n.

Explanation:

Click to correct the three capitalization errors.
In the mid-nineteenth century, americans headed West in record numbers in
search of more land and better opportunity,
Submit


Answers

Answer: In the middle nineteenth-century Americans headed west and the record numbers in search of more land and better opportunity

Explanation:

The three capitalization errors are in the mid-nineteenth century, americans headed West in record numbers in search of more land and better opportunity.

What are capitalization error?

Capitalization error occur when a word is capitalized when it doesn't need to be, or when a word is not capitalized when it should be. Capitalization error should never be used in writing because they detract from the reader's experience.

In the given instance American word is collective noun and represent the native people of country America or  USA. Further Mid-nineteenth century represent the particular era of something specifically, that shall also be capitalized with M. Lastly, West shall be in small letter because it does not represent the region, it says about direction.

The key words that has error are americans, mid nineteenth century and west direction.

Thus , marking a word's first letter capitalized is the process of capitalizing a word (an uppercase letter). It can also be used to describe the condition of being capitalized.

Learn more about Capitalization Error:

https://brainly.com/question/29324930

#SPJ2

The outsiders


what is ponyboy reaction to death of dally and johnny.

Help plz if u have read the book.

Answers

Answer:

He was shocked and scared

Why did the Dakota think there should be a war?

Answers

Answer:

"You know how the war started by the killing of some white people near Acton, in Meeker County. Some Dakota seized that moment to declare war to reclaim their homelands from the whites who would not keep their promises. In the early morning hours of August 18, they went to war.

Darkness descended upon us, is this an active or passive voice?

Answers

Darkness descended upon us - It’s passive voice

The air was thick. As I walked into the room to find an empty chair, I could feel the steam around me. Eyes felt like daggers through my
body. I waited motionlessly for the meeting to start, my heart beating wildly and my mouth dry.
The principal began with his Introductions and described the purpose of the meeting. We were to brainstorm ways of dealing with the issue
In a positive manner. Once suggestions were started, they began rolling in like waves. The air suddenly became easier to breathe. My body relaxed
and my pulse settled down. Maybe I could even speak up with my own ideal
How did the narrator feel at first?
O 1. slightly embarrassed because there was no place to sit
2. out of breath because of the lack of oxygen
O 3. bored because the meeting was not personally important
4. anxious and uneasy because of the tension in the room

Answers

Answer:3

Explanation:

Ignore this part

Answer:

3

Explanation:

i took the test

use the following words in sentences of your own consciousness​

Answers

Answer:

use the following words in sentences of your own consciousness

where are words ?

What are the words?

"President Cleveland, Where Are You?" takes place during the American Great Depression. How does this setting affect the story? Because the drugstore stops selling cowboy cards, Jerry and his friends start collecting president cards. Because Jerry does not contribute all his money toward his father's birthday gift, he feels guilty afterwards. Because the boys collect and study president cards, they earn high marks on their history essays. Because Armand cannot afford new shoes and flowers for Sally, he feels he cannot attend the dance.

Answers

Answer: the answer is Down below

Explanation:

President Cleveland highlights Jerry's struggle to choose between helping himself or helping his brother,

What is a president?

The president is the title that was given to the head of the state of republics. The president of a country is, generally speaking, the head of the government and the first harmonic leader of the country or the ceremonial occasion head of state.

President Cleveland, Where Are You The story takes place in the 1930s during the Great Depression and sets the tone for the coming-of-age tale about love and sacrifice. In the climax scenes of the story, Jerry tells Roger that he sold his Cleveland card to Rollie Tremaine.

Therefore, option(D) is correct.

Learn more about the president here:

https://brainly.com/question/497462

#SPJ2

The options are.

It creates tension between Jerry and the other boys when he finds a Cleveland card.

It highlights Jerry's struggle to choose between helping himself or helping his brother,

It leads to the Frenchtown boys' confrontation with kids from the North Side.

It destroys the relationship between Jerry and his best friend Roger.

PLEASE HELP ASAP!!!!!!!!!!!!
Which shared psychological traits can advertisers use to influence buying decisions? (Select all correct answers.)

1. the need for belonging
2. empathy toward others
3. natural curiosity
4. the desire to be remembered

Answers

Answer:

no.1 and 3 is that your answer

Answer:

1 and 3 i hope this help you

Select the correct answer.


Read “My Heart Leaps Up When I Behold” by William Wordsworth. Which of these themes does the poem contain?


My heart leaps up when I behold

A rainbow in the sky:

So was it when my life began;

So is it now I am a man;

So be it when I shall grow old,

Or let me die!

The Child is the father of the Man;

And I could wish my days to be

Bound each to each by natural piety.


A.

love of nature

B.

the cycle of life

C.

adoration of God

D.

the wisdom of old age

I WILL MARK BRAINLIEST!!

Answers

Answer:

The answer is the cycle of life.

Explanation:

He talks about his life beginning, becoming a man, and growing old.

The  themes the poem “My Heart Leaps Up When I Behold” by William Wordsworth contain is :

B. The cycle of life

“My Heart Leaps Up When I Behold” by William Wordsworth

The  themes the poem “My Heart Leaps Up When I Behold” by William Wordsworth contain is the cycle of life.The poem  is around the ponders of nature and its numerous relations to the human life itself. The rainbow could be a allegory for nature's magnificence, and the speaker's reverence, delight and childlike interest imply the bond he feels with nature.

Thus, the correct answer is B.

Learn more about "William Wordsworth":

https://brainly.com/question/5994807?referrer=searchResults

question is on picture​

Answers

Answer:

B

Explanation:

it seems most fitting

Passage: This city has a gazillion museums and historic places.


What is a more appropriate way to rewrite sentence 2 from the passage?
A.
This city has many different museums and tons of other cool stuff.
B.
This city has numerous museums and historic places.
C.
This awesome city has a gazillion museums and historic places.
D.
This city has lots of museums and historic places.

Answers

(B) This city has numerous museums and historic places.

Read the excerpt from Sampson’s speech in We Beat the Street.

Classes lasted every day until five, and after dinner they went to required tutoring sessions, where each student got help in areas of need. Their test scores began to rise. In the evening the students were required to study. No television was allowed during study hours, and bedtime was mandatory at ten P.M., which none of them liked very much.

"This feels like boot camp,” Sampson whispered to Rameck one night after lights out.

"Yeah, but it feels good, man. It’s like doing push-ups with my brain!”

What effect does the program have on Rameck?

Answers

Answer:

c

Explanation:

I took the test

Answer:

He appreciates the academic intensity.

Explanation:

PLEASEE HELP ME BRO !!!!!Adrian Miller is accused of sneaking lnto the school to try to change his
grades. Which plece of evidence from source 2 most conflcts with Alma's
claim that she saw Adrian entering the school?
SOURCE 1: Testimony of Alma Fernandez Thls time of year, I usually
come to school on Saturday between 3:00 p.m. and 7:00 p.m. to help
Coach Rawls sort cases for the debate team, because the Nebraska
state debate tournament is coming up soon. He asked me to take
some files over to the administration bulding, and on my way I saw
Adrian sneaking in.It was too dark out to see his face, but I recognized
his hoodie because it has tiger stripes on it.
SOURCE 2: Report on Adrian Mllers movements: Adian clocked into
work at Chuck's Quick Grille at 10:59 a.m. The cooks reported him
missing at around 12:30 p.m., and the manager noticed that his car
was missing from the parking lot at that time, though his tiger-striped
sweatshirt was still hanging in the break room. A local traffic camera
spotted his car moving up Grape Avenue at 1:07 p.m. Adrlan returned
to work at a 2:40 p.m, and several witnesses noted that he stayed
there until closing time at 9:00 p.m.

Answers

Answer:it was too dark out to see his face

Explanation:

please help me

will give brainliest for any that answer them right ​

Answers

Answer:

Opportunity cost is the value of the next best thing you give up whenever you make a decision. It builds discipline and it creates a healthy work (reward cycle).Saving is setting aside the money you don't spend now for emergencies or for a future purchase. Investing is buying assets such as stocks, bonds, mutual funds or real estate with the expectation that your investment will make money for you.

BRAINLIST PLS!

Other Questions
Three hundred cars drove over a bridge in 23 minutes. At that rate, howmany cars would drive over the bridge in 138 minutes? Rule-of-thumb budgeting is budgeting that's popular with the hospitality and tourism industry because it's so effective. trueorfalse can someone please answer these and explain how you did it2x - 7 = 117x + 1 = 223x - 8 = 228x +5 = 45 write the code for RNA from this DNA STRAND :AAAAAATTTTTTCCCGGGGTTTATATATC A store receives customer satisfaction ratings that range between 0 and 100. In the first 13 ratings the store received, the average customer satisfaction rating was 75. What is the least value the store can receive for the 14th rating and still be able to have an average of at least 84 for the first 21 ratings? What is the main purpose of foreign aid? Describe the religions of the early Indigenous peoples. Only________ can declare war! which sea would a boat pass through traveling from South Korea to Japan Brent has to complete a final group project and his group members aren'tdoing their share of the work. Brent generally believes in being kind to others,but at the last group meeting, he was so frustrated that he yelled at the groupand threatened to stop working on the project. Which value system is mainlyin question here?A.ethics B.lawC.business lawM.morality If 10 percent of a number equals 30, find 40 percent of that number. RIP grandsonhow does earths crust change earths surface Christine's middle school total of 900 students and 45 teachers. The local high school has 110 teachers and a student-teacher ratio propotional to the middle school's. How many students find when she gets to high school What type ofenergy travels in the form of electromagnetic waves? A: Chemical Energy B: Gravitational EnergyC: Nuclear Energy D: Radiant Energy According to the map, Italy in the early 19th century was under the control of Austria. under the control of Spain. united as the Kingdom of Italy. split into kingdoms and city-states. Calculate the heat energy needed to change the temperature of 2 kg of copper from 10C to 110C.If you could show your process and equations used, that would be very helpful! Thanks! Solving Two Step Linear Equations. SHOW YOUR WORK. 1. 9x - 7 = -72. -15 = -4m + 5 3. -2x + 4 = -124. x/8 + 4 = 35. x/7 + 5 = 126. 5 = x/-19 - 2 "That ball 'bolted' by so fast." What does the word 'bolted' mean in this sentence? [2.1 + (9.2 x 3.3)] x 0.8 What is the value of 2x + 6 when x = 10? Please help a girl out