Answer: All of the answers are correct.
Explanation:
Membrane proteins are sometimes covalently attached to lipid moieties. They're also composed of the same 20 amino acids found in soluble proteins and diffuse laterally in the membrane unless they are anchored. They're sometimes covalently attached to carbohydrate moieties as well.
Therefore, the correct option is All of the above.
who do study edexcell certificate level? and can help be physics,chemistry and biology exam
I have done GCSE sciences and also applied science a level so I could probably help you :)
Brain researchers have found wider surface fissures, enlarged ventricles, and atrophy of the brain areas for regulating motivation, emotion, attention, actions, and perception in persons suffering from:________
a. bipolar disorder.
b. schizophrenia.
c. multiple personalities.
d. conversion disorders.
Answer:
B. Schizophrenia
Explanation:
yes
An older woman is transported to the hospital on Thanksgiving Day. While visiting with family for the holiday, the woman fell out of her chair and was unresponsive to her family. Upon arrival to the emergency department, the family reports that the woman lives independently. Before her current state, she recognized family members and was speaking normally. She begins to arouse, and her family notes that she seems unaware of her surroundings and does not respond to questions.
A defect of recognition may be tactile, visual, or auditory. These are known as:___________
Answer:
Agnosia typically is defined as the inability to recognize sensory stimuli. Agnosia presents as a defect of one particular sensory channel, such as visual, auditory, or tactile.
2 True or False. A projectleie an object that once set in motion continues in motion by its own martia O True False
Answer:
The answer is true.Explanation:PARTICLES MOVING ALONG THE PATH POSSES A TWO DIMENSIONAL MOTIONMARK ME AS BRAINIST PLZ
Which quantity does a light year measure
Answer:
distance = 9.46 trillion kilometers
Explanation:
Light years measure distance and is a unit that equals the distance light travels through space in one year on Earth (365 days) and is used as way to measure extremely vast distances in outer space. It equals 9.46 trillion kilometers.
Provide details about Meiosis.
animal cell vs plant cell
Answer:
animal cell
Explanation:
Help me out with this again, pretty please?
(2nd time)
I need explanation for your answers, even though it's multiple choices, I still need your explanation for it.
DUE TOMORROW!
If your answer is NONSENSE it will be deleted as soon as possible!
But if your answer is CORRECT, HELPFUL, HAS AN EXPLANATION, I'll chose your answer as the BRAINLIEST ANSWER!
If a diploid cell has 20 chromosomes, how many sister chromatids will be present
during PROPHASE of MITOSIS?
Answer:
92 chromatids
Explanation:
During phosphate, the nuclear envelope of the cell (which is where the 92 chromatids are contained) begins to break down. The centrioles, which are the only present in animal cells, separate and each moves to an opposite end of the cell
What are the best management practices for Maize grain crop, by adopting which we can boost yield, elaborate in details your expert opinion.
Answer:
Cultivate prime grain and with timely care
The predominant forms of actin inside a cell are ATP-G-actin and ADP-F actin. What would be the consequence for actin filament assembly/disassembly if a mutation prevented actin's ability to bind ATP
Answer:
If actin is unable to bind to the ATP molecule, it will not be able to assemble into its two dominant forms.
Explanation:
As shown in the question above, the two predominant forms of actin are ATP-G-actin and ADP-F actin. As we can see, the formation of these two molecules involves the presence of an ATP molecule, in which case, the concentration of actin inside an organism depends totally on the capacity of the actin to be able to bind to an ATP molecule. If there is a mutation that prevents this binding from occurring, actin will not be able to form its two dominant forms, which will harm the presence of actin in the body.
Which genotype would give you a wild type phenotype?
Answer:
C
Explanation:
What is the term that refers to a deep divide between tissues of the brain?
Gyrus
fissure
sulcus
fusior
Answer:
fissure!
Explanation:
Which of these is a benefit of fish farming?
A. It can deplete native fish populations
B. It can restock lakes depleted by recreational fishing
C. It can pollute natural bodies of water
D. It can pass diseases to native fish populations
Answer:
The answer to this would be B
Explanation:
B:It can restock lakes depleted by recreational fishing
Given the latitudinal differences in sunlight intensity, how might you expect the carrying capacity of a plant species found at the equator to compare with that of a plant species found at high latitudes? Explain your answer
Answer:
The carrying capacity of a plant species expect in the equator is higher as compared to the carrying capacity at high Latitudes. This is due to the equator the plants have more light available, so the ecosystem can give them better conditions to survive and reproduce. Remembering that the carrying capacity is the largest population size an ecosystem can support without degrading itself, in the equator would be higher as it can have better conditions of light, so they would survive and reproduce more and the largest population the ecosystem could support would be higher.
does tomato have thick or thin exocarp?
State three ways of increasing the life-span of cut flowers
Answer:
Clean your vase thoroughly, Keep flowers away from fruit, Flower Food and Water
Explanation:
Consider the following statements:
1. RNA is ribonucleic acid.
2. RNA is used for information transport (known as mRNA). Choose the correct answer from the given codes:
A Only 1
B Only 2
C Both
D Neither 1 nor 2
E None of the above
Answer:
Only A
Explanation:
RNA is used for storing and transporting information through mostly virus only..
How does water relate to the ability of a living thing to generate usuable energy?
Answer:
Without the proper balance of water, chemical reactions in cells could not take place.
Explanation: :)
At a birthday party, a teen decides to inhale some of the helium from a nearby balloon using his mouth. Before the helium gas reaches his right and left lungs, through which order of structures will it flow?
A. Oral cavity to the oropharynx to the trachea to the right and left main bronchi.
B. Oral cavity to the trachea to the trachea to the nasopharynx to the right and left main bronchi.
C. Oral cavity to the right and left main bronchi to the trachea to the oropharynx.
D. Oral cavity to the trachea to the larynx to the right and left main bronchi.
E. Oral cavity to the nasopharynx to the trachea to the right and left main bronchi.
Answer:
D. Oral cavity to the trachea to the larynx to the right and left main bronchi.
Explanation:
The respiratory system may be a system consisting of specific organs and structures used for gas exchange in animals and plants.
What is the process of respiration?We have a pair of external nostrils opening out above the upper lips. It results in a nasal chamber through the nasal passage. The nasal chamber opens into the pharynx, some of which are the common passage for food and air. The pharynx opens through the larynx region into the trachea.Trachea is a straight tube extending up to the mid-thoracic cavity, which divides at the extent of the 5th thoracic vertebra into a right and left primary bronchi. Each terminal bronchiole gives rise to a variety of very thin, irregular-walled, and vascularized bag-like structures called alveoli. The branching network of bronchi, bronchioles, and alveoli comprise the lung.
Thus, we can conclude that the correct option is (e).
The oral cavity to the nasopharynx to the trachea to the right and left main bronchi.
You can learn more about the respiratory system here:
https://brainly.com/question/2619922
#SPJ2
The following statement is incorrect as stated "Pesticides create pesticide resistance in mosquitoes." Rewrite this sentence so that it is a more accurate statement of what actually occurs when pesticides are used. Why is this concept important to know in trying to control outbreaks of mosquito transmitted diseases such as eastern equine encephalitis (also known as Triple E)?
Answer:
Mosquitoes usually become resistant to pyrethroids through the mutation of a sodium channel gene that controls the movement of ions across cell membranes. Mutations in a single gene are enough to make mosquitoes almost completely resistant to the level of pyrethroids used in insecticides.
Describe the impact of technology on the environmental today
Explanation:
Other detrimental effects include diseases such as typhoid and cholera, eutrophication and the destruction of ecosystems which negatively affects the food chain. Resource depletion is another negative impact of technology on the environment. It refers to the consumption of a resource faster than it can be replenished
sexually produced offspring are indentical to their parent . true or false ?
14.
(GT.03)
Which of these best matches a source of information with its most reliable use? (2 points)
cladogram → date events which occurred in Earth's past
cladogram → study the evolution of organisms based on adaptations
fossil records → compare the evolution of completely soft-bodied organisms
fossil records → study the behavior of primitive animals in extreme weather conditions
Answer:
petrified fossils → date sedimentary rocks
What is the purpose of a geological time scale ?
It used to predict natural disaters throughout Earth’s history.
It is used to present the correct sequence of events in the Earth’s history.
It is used to determine the absolute dates in years for different periods.
It used to create a naming system for flora and fauna.
Answer: B. It is used to present the correct sequence of events in the Earth’s history.
Explanation: On Edge!!!! :)
Answer:bbbbb
Explanation:
qcw3ec
Pls help thank you
A group of geologists is about to start excavating a new area for fossils. The area they are working in is the side of a cliff. Describe two pieces of information they will most likely be able to discover about the fossils they will find.
Answer:
Forms of fossils and there arrangement with layer of rock.
Explanation:
The seashore is a significant place for the depositional work of waves and it's also one of the significant places for the erosion and weathering of rocks. The presence of sedimentary rocks along the cliffs are essential for the discovery of fossils of plants and animals. Fossils of shells and other creatures that were of marine origin are mostly discovered near excavation sites. Fossil helps to prove the age of rocks and strata.Enter the sequence of the DNA coding strand with a 5-3 polarity. DO NOT WRITE 5 OR 3 OR 5' OR 3' IN THE BOX!
Complete question:
Use the sequence below to answer the following questions
3’-ACGGATCCTCCCTAGTGCGTAATACG-5’
5’-TGCCTAGGAGGGATCACGCATTATGC-3’
1. Enter the sequence of the coding strand with a 5’-3’ polarity
Answer:
coding strand → 5´- GCATAATGCGTGATCCCTAGGCA -3´
Explanation:
When referring to the coding strand, we are talking about the sequence that turns to be the same as the mRNA that results from the transcription of the same DNI segment -switching bases T for U-.
The coding strand receives that name because it is the sequence that codes for each amino acid composing the proteins.
When the DNI molecule separates into two strands to form the transcription bubble, we can identify two separate segments: coding strand and template strand.
The coding strand goes in direction 5´ to 3´, while the complementary strand -template strand- grows in direction 3´ to 5´.
Whenever we have a DNI molecule and we need to determine which strand is the coding one, we just need to look for the presence/absence of start or stop codons.
So, in the exposed example we have two strands, but we do not know yet which one is the coding one.
Conventionally, the first strand is always the coding one. However, let us analyze it by using the presence/absence of codons.
First-strand:
3’-ACGGATCCTCCCTAGTGCGTAATACG-5’
let us write it is 5´to 3´direction
5´- GCATAATGCGTGATCCCTAGGCA -3´
now let us identify the start and stop codons in 5´⇒3´direction.
Start codon ⇒ ATGStop codon ⇒ TAA, TAG, TGA5´- GCATAATGCGTGATCCCTAGGCA -3´ ⇒ 1 start codon at the beginning
5´- GCATAATGCGTGATCCCTAGGCA -3´ ⇒ 3 Stop codons
Second strand: We will do exactly the same procedure
5’-TGCCTAGGAGGGATCACGCATTATGC-3’⇒ 1 start codon near the end
5’-TGCCTAGGAGGGATCACGCATTATGC-3’⇒ 1 stop codon at the beginning
What we did here was to identify in both provided strands, where the start and stop codons are placed. We can see that in the first strand we have the start codon near the beginning, while in the second strand we have it near the end of the sequence. From this information, we can assume that the first strand is the coding one. However, you need to know that some coding sequences do not have start and stop sequences, because they might correspond to a sequence in the middle of a gene.
So, the sequence of the DNA coding strand with a 5-3 polarity is
5´- GCATAATGCGTGATCCCTAGGCA -3´
Lactase is an enzyme that is produced in the lining of the intestines. This enzyme helps the body speed up the
breakdown of carbohydrates that are found in dairy products, such as milk, yogurt, and cheese.
Which general function does lactase perform?
Answer:
Regulation of cell processes
Explanation:
Lactase is an enzyme that helps in the breaking down of disaccharide sugar, lactose, found in many foods. It does it by converting the lactose into its component reducing sugars - glucose and galactose. This enzyme is produced by some special cells lining the intestinal walls of humans and forms a kind of chemical barrier known as brush border where foods must pass through before being absorbed. By so doing, foods are screened for the presence of lactose and any lactose is broken down before the foods are given a pass.
do you think there is the roots in utricularia?
Answer:
I think so
Explanation:
What fraction of the progeny of the cross BbTt x BbTt will have black fur and long tails?
A) 0/16
B) 1/16
C) 3/16
D) 9/16
E) 16/16
Answer:
plzzzz upload a full picture
