Mrs. Bhatia's closet consists of two sections, each shaped like a rectangular prism. She plans to buy mothballs to keep the moths away. She needs one box for every 32 cubic feet of space. How many boxes should she buy?

Answers

Answer 1

Answer:

6.5 boxes

Step-by-step explanation:

Given

See attachment for closet

Required

Determine the number of boxes needed to fill the closet

First, we calculate the volume of the two section.

According to the attachment

The first section has the following dimension:

[tex]Width = 5ft[/tex]

[tex]Length = 4ft[/tex]

[tex]Height = 8ft[/tex]

The second has the following dimension:

[tex]Width = 3ft[/tex] ---- see the last label at the top

[tex]Length = 2ft[/tex] --- This is calculated by subtracting the length of the first section (4ft) from the total length of the closet (6ft) i.e. 6ft - 4ft

[tex]Height = 8ft[/tex]

So: The volume of the closet is:

[tex]Volume = W_1 * L_1 * H_1 + W_2 * L_2 * H_2[/tex]

[tex]Volume = 5ft * 4ft * 8ft + 3ft * 2ft * 8ft[/tex]

[tex]Volume = 160ft^3 + 48ft^3[/tex]

[tex]Volume = 208ft^3[/tex]

The number of box needed is then calculated by dividing the volume of the closet (208ft^3) by the volume of each box (32ft^3)

[tex]Boxes = \frac{208ft^3}{32ft^3}[/tex]

[tex]Boxes= \frac{208}{32}[/tex]

[tex]Boxes = 6.5[/tex]

Mrs. Bhatia's Closet Consists Of Two Sections, Each Shaped Like A Rectangular Prism. She Plans To Buy

Related Questions

What is 1/6 equal to as a fraction

Answers

2/12
3/18
4/24

Simply multiply and divide

Answer: 2/12

3/18

4/24

Step-by-step explanation:

The population in Smalltown in 2010 was 45,230 people and is growing at a rate of 2%. What will the population be in 2030?

Answers

Answer:

67475

Step-by-step explanation:

Let P(t) = population t years after 2010 

 

            = 45230e0.02t

 

Population in 2030 = P(20)

 

                            = 45230e0.4≈ 67475

HELP PLS MIGHT GIVE BRAINLIST BUT ONLY IF 2 PEOPLE ANSWER!

Answers

Answer:

Step-by-step explanation:

Part A: (3,2)

connect all the points on the paper

Part B: 5 units.  We know this since the x point for A is -2 and the point for B is 3.  -2 to 3(absolute value of -2 plus 3)= 5

Solve for h. What is h?
Problem 20h=2

Answers

Answer:

h=1/10

Step-by-step explanation:

Can someone please help me with this?

Answers

1 or 2 or both ?????????

2.

Select the correct answer.

The national apple growers organization recently released its first crop of a new apple variety. It gathered data on the weight of the new apples.

It found a population mean of 4.85 ounces and a standard deviation of 0.92. Each sample size was 500 apples. By the central limit theorem,

which interval do 99.7% of the sample means fall within?

OA.

4.81 and 4.89

OB.

4.73 and 4.97

Ос. .

4.84 and 4.86

OD

4.77 and 4.93

Answers

Answer:

B. 4.73 and 4.97

Step-by-step explanation:

To solve this question, we need to understand the Empirical Rule and the Central Limit Theorem.

Empirical Rule:

The Empirical Rule states that, for a normally distributed random variable:

Approximately 68% of the measures are within 1 standard deviation of the mean.

Approximately 95% of the measures are within 2 standard deviations of the mean.

Approximately 99.7% of the measures are within 3 standard deviations of the mean.

Central Limit Theorem

The Central Limit Theorem estabilishes that, for a normally distributed random variable X, with mean [tex]\mu[/tex] and standard deviation [tex]\sigma[/tex], the sampling distribution of the sample means with size n can be approximated to a normal distribution with mean [tex]\mu[/tex] and standard deviation [tex]s = \frac{\sigma}{\sqrt{n}}[/tex].

For a skewed variable, the Central Limit Theorem can also be applied, as long as n is at least 30.

Central Limit Theorem

The Central Limit Theorem estabilishes that, for a normally distributed random variable X, with mean [tex]\mu[/tex] and standard deviation [tex]\sigma[/tex], the sampling distribution of the sample means with size n can be approximated to a normal distribution with mean [tex]\mu[/tex] and standard deviation [tex]s = \frac{\sigma}{\sqrt{n}}[/tex].

For a skewed variable, the Central Limit Theorem can also be applied, as long as n is at least 30.

Standard deviation of 0.92, sample of 500:

This means that [tex]\sigma = 0.92, n = 500, s = \frac{0.92}{\sqrt{500}} = 0.04[/tex]

By the central limit theorem, which interval do 99.7% of the sample means fall within?

Within 3 standard deviations of the mean. So

4.85 - 3*0.04 = 4.85 - 0.12 = 4.73

4.85 + 3*0.04 = 4.85 + 0.12 = 4.97

So, option B.

Answer:

4.73 and 4.97

Please give me brainliest, I really need it.

(help?)
Look at the model.
Which of the following statements of equality is true? [png]

Answers

Answer:

H

Step-by-step explanation:

Answer:

H

Step-by-step explanation:

3 times 2 and x in each row

which equals to 6 and 3x

what is an outlier number?

Answers

Answer:

an outlier is a number that is at least 2 standard deviations away from the mean for example in the set 1,1,1,1,1,1,1,1,1,7,7,7 would be the outlier

Step-by-step explanation:

watashi wa sore ga tadashī koto o negatte imasu

arigatozaimasu!!

Step-by-step explanation:

i have noooo idea but ayyeee

"Debby" is a photographer. She sells small prints for$50 and large prints for $75. How many large prints did she sell?

Answers

she didn't sold any large print that is the price on how she sells the prints

keiko has bought 36pounds of dog food, she feed the dog 3/4 pound of food each meal. how many meals would this last

Answers

Answer:

48 meals

Step-by-step explanation:

36lbs ÷ 3/4lbs = 48

Find the slope of a line that passes through the following points (3,2) (5,-3)

A. 2/5
B. 5/8
C. -5/2
B. -5/8

Answers

Answer:

C

Step-by-step explanation:

Use the slope formula:

m = (y2 - y1) / (x2 - x1)

m = (-3 - 2) / (5 - 3)

m = -5/2

A graduate student conducted a study of field mice in rural Kansas. The student obtained a sample of 100 field mice and recorded the weight, in grams, of each mouse. The mean and standard deviation of the recorded weights are 35 grams and 2.4 grams, respectively. After the measurements were taken, it was discovered that the scale was not calibrated correctly. The student adjusted the 100 measurements by subtracting 3 grams from each measurement. What are the values of the mean and standard deviation of the corrected measurements

Answers

Subtracting 3 from all measurements, it is found that:

The mean will decrease by 3.The standard deviation will remain constant.

What are the mean and the standard deviation of a data-set?

The mean of a data-set is given by the sum of all values in the data-set, divided by the number of values.The standard deviation of a data-set is given by the square root of the sum of the differences squared between each observation and the mean, divided by the number of values.

From this, we have that:

When 3 is subtracted from all measures, the sum of all observations will be subtracted by 3 x 100 = 300, hence the mean will decrease by 3.The mean decreases by 3, as does each observation, hence the sum of the differences squared between each observation and the mean remains constant, as does the standard deviation.

More can be learned about the standard deviation of a data-set at https://brainly.com/question/12180602

#SPJ1

-7/9x9/8 what is the answer

Answers

Here is what I got
Anyways I have to write 20 words so here they r

2. A student measured the mass of an object
to be 56 g, but the actual mass was 53 g.
What is the absolute error?
Quickkkkkk

Answers

There answer .......

The absolute Error is 5.66%.

What is absolute Error?

The discrepancy between a quantity's measured or inferred value and its actual value is known as the absolute error.

The absolute error is insufficient because it provides no information about the significance of the error. An inaccuracy of a few centimetres when estimating the kilometres between cities is insignificant and unimportant. A measurement mistake of a few centimetres when measuring tiny machine parts is a highly important defect. Although both inaccuracies are in the centimetre range, the second one is more serious than the first.

Given:

Actual Mass = 53g

and, Measure mass= 56 g

So, Absolute Error = | 56- 53 / 56| x 100

Absolute Error = |3 / 56| x 100

Absolute Error = 0.056603 x 100

Absolute Error = 5.66%

Hence, the absolute Error is 5.66%.

Learn more about Absolute Error here:

https://brainly.com/question/11599357

#SPJ2

I need help with this

Answers

Answer:

1/5

Step-by-step explanation:

because u divied

1. Alice invests $1000 at 2% interest compounded monthly over a 5 year period. Assuming no other money is deposited or withdrawn, what is the total amount of money in her account after 5 years? (Round to the nearest cent)​

Answers

Answer:

$1,105.08.

Step-by-step explanation:

Given that Alice invests $ 1000 at 2% interest compounded monthly over a 5 year period, assuming no other money is deposited or withdrawn, to determine what is the total amount of money in her account after 5 years, the following calculation must be performed:

X = 1,000 (1 + 0.02 / 12) ^ 5x12

X = 1,105.08

Thus, the amount of money in her account after 5 years would be $ 1,105.08.

what is the value of k if - 2/3(k - 6) = 3/2(k+6)​

Answers

*☆*――*☆*――*☆*――*☆*――*☆*――*☆*――*☆*――*☆**☆*――*☆*――*☆*――*☆

Answer:  -30/13

I hope this helped!

<!> Brainliest is appreciated! <!>

- Zack Slocum

*☆*――*☆*――*☆*――*☆*――*☆*――*☆*――*☆*――*☆**☆*――*☆*――*☆*――*☆

Which of the following is the correct way to state the similarity between these two figures?

A.) ABCDE ~ YXVZW


B.) ABCDE ~ VWXYZ


C.) ABCDE ~ VZWYX


D.) ABCDE ~ ZWYXV

Answers

Answer:

ABCDE is similar to the ZWYXV

The Environmental Protection Agency (EPA) uses a measure called the Pollutant Standards Index (PSI) to measure air quality in a city. A PSI reading over 100 indicates a day when the air quality is considered unhealthy. The measurements represent the number of days in 1995 that the PSI was over 100 for metropolitan areas in the U.S. Midwest. Summary statistics are provided.

0, 0, 0, 1, 1, 1, 1, 1, 2, 2, 3, 4, 4, 4, 4, 5, 7, 7, 11, 14

Required:
Draw the boxplot for this data we found no extreme outliers.

Answers

Answer:

Please find attached the Box Plot Created with Microsoft Excel

The outliers are 11, and 14

Step-by-step explanation:

The given data is presented as follows;

0, 0, 0, 1, 1, 1, 1, 1, 2, 2, 3, 4, 4, 4, 4, 5, 7, 7, 11, 14

From the data, we have;

The first quartile, Q₁ = 1

The second quartile, (The median) Q₂ = 2.5

The third quartile, Q₃ = 4.75

Therefore, the interquartile range, IQR = Q₃ - Q₁ = 4.75 - 1 = 3.75

Therefore, the values above Q₃ + 1.5 × IQR are outliers

Q₃ + 1.5 × IQR = 4.75 + 1.5 × 3.75 = 10.375

Therefore, 11, and 14 are outliers

The boxplot created with Microsoft Excel is attached

The sum of a number times 8 and 23 is at most 26.
Use the variable b for the unknown number

Answers

Answer:

b ≤ 3/8

Step-by-step explanation:

Let the unknown number be b.

Translating the word problem into an algebraic expression, we have;

8b + 23 ≤ 26

Rearranging the equation, we have;

8b ≤ 26 - 23

8b ≤ 3

Dividing both sides by 8, we have;

b ≤ 3/8

Angel and Kellie each have the same amount of money in their wallet. Angel buys two juice drinks and receives $1.10 in change after she pays. Kellie buys 1 juice drink and receives $3.05 in change after she pays. Which equation shows how to find the cost of a juice drink, j?

Answers

Answer:

y= 2x+1.10

y=x+3.05

Step-by-step explanation:

NO LINKS PLEASE HELP ME ​

Answers

Answer

angle 5 = 31°

Step-by-step explanation:

Answer:

31 degrees

Step-by-step explanation:

Angles 1, 5, and 6 combine to form a straight line, which is 180 degrees, so add 56 and 93 and subtract that from 180

If Sheyenne walked 8 miles in 2 hours what was her speed?

Answers

Answer:

4 miles per hour

Step-by-step explanation:

Answer:

4mph

Step-by-step explanation:

8 divided by 2 and boom the answer.Hope this helps.

Find the value of x.

Plsss help

Answers

Answer:

x=6

Step-by-step explanation:

7x+5+13x-8+11x-3=180

31x-6=180

31x=186

x=186÷31

x=6

I wrote the wrong answer so I erased it

A 13-foot ladder leaning against a building meets the side of the building exactly 12 feet above the ground. How far from the building is the base of the ladder rounded to the nearest hundredth foot?

Answers

Answer:

At the moment in question, we have a 5-12-13 right triangle.

x^2 + y^2 = 13^2

2x dx/dt + 2y dy/dt = 0

2(5)(2/3) + 2(12) dy/dt = 0

dy/dt = -5/18 ft/s

the area is 1/2 xy, so

da/dt = 1/2 y dx/dt + 1/2 x dy/dt

= (1/2)((12)(2/3) + (5)(-5/18))

= 119/36

Step-by-step explanation:

What is the interest you will pay if you borrowed $120 at 5% interest for 6 years?

Answers

Answer:

Hope this helps!

Step-by-step explanation:

We will need the loan payment formula:

That formula is really complex and we expect you to solve it.

Your monthly payment would be $1.93 per month for 6 years making the TOTAL loan cost 1.93 * 12 * 6 = 138.96

Since the principal you borrowed is $120 the total interest =

(138.96 minus 120.00) which equals $18.96

Answer:

The answer is 36

Step-by-step explanation:

120*0.05=6

6.6=36

PLS HELP ME
The smallest hummingbird is the Bee hummingbird. It has a mass of about 1
1
4
grams. The mass of a larger type of hummingbird is about 6 times the mass of the Bee hummingbird.

What is the mass of the larger hummingbird?

Answers

Answer:

The mass of the larger hummingbird is 7 1/2 or 15/2.

Step-by-step explanation:

Bee hummingbird = 1 1/4g

Larger hummingbird = 6x that

So,

1 1/4 x 6 = 7.5

7.5 as fraction = 7 1/2 or 15/2

Choose the function whose graph is given below.

A. y = sec X
O B. y = tan x
O C. y = CSC X
O D. y = cotx

Answers

Answer: B. y = tan x

Step-by-step explanation:

The function whose graph is show below will be tan x. Then the correct option is B.

What is trigonometry?

The connection between the lengths and angles of a triangular shape is the subject of trigonometry.

The secant of angle x is not defined, for some value of x. Then the domain of the sec x will be

Domain = R – (2n + 1) π/2

But the graph of the sec x looks like U. Then it is incorrect.

The tangent of angle x is not defined, for some value of x. Then the domain of the tan x will be

Domain = R – (2n + 1)π/2

Then it is correct.

The co-secant of angle x is not defined, for some value of x. Then the domain of the csc x will be

Domain = R – nπ

Then it is incorrect.

The co-tangent of angle x is not defined, for some value of x. Then the domain of the cot x will be

Domain = R – nπ

Then it is incorrect.

Then the correct option is B.

More about the trigonometry link is given below.

https://brainly.com/question/22698523

#SPJ5

The diameter of the washers are required to be between 1.53 millimeters and 1.65 millimeters long. Any washers that do not meet this requirement must be discarded. What percentage of washers will the factory have to discard

Answers

Answer:

32%

Step-by-step explanation:

Let x be the mean of the values and σ their standard deviation.

Since the minimum value of the diameter of the washers is 1.53 mm, then

x - σ = 1.53 mm  (1)

Also, the maximum value of the diameter of the washers is 1.65 mm, then

x + σ = 1.65 mm  (2)

Adding (1) and (2), we have

x - σ = 1.53 mm

+

x + σ = 1.65 mm  

2x = 3.18

x = 3.18/2

x = 1.59 mm

Subtracting (1) and (2), we have

x - σ = 1.53 mm

-

x + σ = 1.65 mm  

-2σ = -0.12

σ = -0.12/-2

σ = 0.06 mm

Since the diameter of the washers are required to be between 1.53 millimeters and 1.65 millimeters long, and x - σ = 1.53 mm to x + σ = 1.65 mm are the required values, 68% of the washers lie in this range. The other values lie outside this range. The amount that the factory would have to discard is 100% - 68% = 32%

This question is based on the percentage. Thus, 32%  of washers will the factory have to discard.

Given:

The diameter of the washers are required to be between 1.53 millimeters and 1.65 millimeters long.

We need to determined the percentage of washers will the factory have to discard.

According to question,

Let x be the mean and σ be their standard deviation.

The minimum value of the diameter of the washers is 1.53 mm.

Then,

x - σ = 1.53 mm  (1)

Also, the maximum value of the diameter of the washers is 1.65 mm, then

x + σ = 1.65 mm  (2)

Adding (1) and (2), we have

   x - σ = 1.53 mm  

+  x + σ = 1.65 mm  

⇒ 2x = 3.18

We get,

x = 1.59 mm

Subtracting (1) and (2), we have

 x - σ = 1.53 mm

- x + σ = 1.65 mm  

⇒ -2σ = -0.12

We get,

σ = 0.06 mm

Therefore, the diameter of the washers are required to be between 1.53 millimeters and 1.65 millimeters long, and x - σ = 1.53 mm to x + σ = 1.65 mm are the required values, 68% of the washers lie in this range.

And the other values lie outside this range. The amount that the factory would have to discard is 100% - 68% = 32%.

Thus, 32%  of washers will the factory have to discard.

For more details, prefer this link:

https://brainly.com/question/13703753

Pls help I’ll brainlest and add extra points

Answers

Answer:

11) m<8

12) a<-64

13) f<140

14) t> or equal to 150

15) g<-18

16) y< or equal to -16

17) a> or equal to 16

Step-by-step explanation:

hope this helps

Other Questions
How was religion in ancient Rome similar to religion in ancient Greece? (Choose 3)ARoman gods had the same names.BRoman gods had human-like qualities.CRoman religion was polytheistic.DRoman gods were different aspects of one God.ERoman religion included a holiday called Saturnalia.FRoman gods played an important role in everyday life by protecting families, homes, farms and even animals. Rewrite the number in Standard form6 x 10^8 What is the main source of winds and weather? A. The spinning EarthB. The Earth's rotation on its axisC. The layers of the planetD. The sunI will mark correct answer brainliest 3+4-8+9-8+78+99-7999+8799+06997+90797883+677_5= May someone help me with this :) Describing Work ActivitiesNote that common tasks are listed toward the top and less common tasks are listed toward the bottom.According to O*NET, a pharmacy technician should be able to use computers to enter, access or retrieve data to adhere to safety procedures and use the metric system.What Work Activities are being described? Check all that apply.a. processing informationb. getting informationc. interacting with computersd. evaluating information to determine compliance with standardse. identifying objects, actions and eventsf. updating and using relevant knowledge 13. Given the original DNA strand, which of the following would be the new, complementary strandof DNA? ACTTACGCCGAT *(8 Points)CAGGCATAATCGACTTACGCCGATTCAATCGCCGTATGAATGCGGCTA Can someone please help me fix the errors?Please don't answer if you don't know Arrange the following steps to explain the process of protein synthesis inside the eukaryotic cell. Help please! 50 points! Troll answers WILL be reported Describe how each of thefollowing are evidence for Continental Drift1. Fossils2. Landforms3. Rock Formations4. Climate what is 3/4x2/3a.5/12b. 6/12c.5/7d. 6/7 How to not go to jail for j walking (HELP ASAP)Select the graph which best represents this scenario:The amount of pancake batter that you must mix increaseswith the number of people who come to breakfast. It takes3 cups of batter to serve 10 people.(More context in the picture) What is not a type of text format that will automatically be converted by Outlook into a hyperlink?O email addressO web addressO UNC pathO All will be automatically converted. Cup G has a diameter of 4 in. and a height of 8 in. Find the volume of Cup G. James is twice as old as Hannah. Four years from now, the sum of their ages will be 41. How old are they now? (24^0)+(4^0). solve this problem fast Class A misdemeanor, based on the federal level, has a maximum fine of which of the following? Where dose the earliest known Indian literature come from