Answer: The pulmonary artery (carries blood from the heart to the lungs), and the pulmonary vein (carries blood from the lungs to the heart).
Answer:
Veins carry to the heart, and arteries carry blood from/away from the heart.
Explanation:
The pulmonary artery carries (oxygenated/oxygen rich) blood from the heart to the lungs, while pulmonary veins carry (deoxygenated/oxygen poor) blood to the heart, from the lungs.
the volume of a human brain is normally about 1200cm3. the osmolarity of solutes in the cerebrospinal fluid surrounding the brain is normally about 300mM. how does the volume of the brain change when the cerebrospinal fluid osmolarity drops to 280mM
Answer:
yesterday was a temporary password is goes by
Which polymers contain nitrogen?
A.starch
B.glycogen
C.cellulose
D.chitin
E.amylopectin
Answer:
Chitin
Explanation:
Chitin is a polysaccharide containing nitrogen
Unlike most organisms the white-tailed deer has thrived in disturbed areas. Explain at least two ways that the increasing human population has and will continue to impact the white-tailed deer population. In your response, be sure to address both living and nonliving limiting factors.
Answer: https://ecosystems.psu.edu/outreach/youth/sftrc/deer/wtd-lesson3
go into this link your answers is discover
Explanation:
Water, food, vegetation and shelter are the factors that reduce the population of white-tailed deer due to human involvement in that environment.
Which living and non-living factors affect population?Both living and nonliving limiting factors such as water, food, vegetation and shelter are the factors that reduce the population of white-tailed deer because these factors are now used by humans so there is nothing left for the survival of white-tailed deer.
So we can conclude that water, food, vegetation and shelter are the factors that reduce the population of white-tailed deer due to human involvement in that environment.
Learn more about population here: https://brainly.com/question/25630111#
discuss the ecological importance of the dark phase
Answer:
In the dark phase (which takes place in the stroma), the ribulose bisphosphate added to the carbon dioxide gas (CO2) in the air results in the production of organic compounds, principally carbohydrates or sugars, whose molecules contain carbon, hydrogen, and oxygen.
Explanation:
Which statements describe organic compounds
Answer:
i don't know
Explanation:
twrnsjshdhidid
If Earth didn't rotate, what would be one major obstacle life would have to
overcome?
Answer:
A major obstacle life would have to overcome is having only a limited amount of natural light and then the rest of the time is darkness.
A hypothesis that is non-falsifiable is ___________.
Answer:
Si no es posible refutarla, dicha teoría queda «corroborada», pudiendo ser aceptada provisionalmente, pero no verificada; es decir, ninguna teoría es absolutamente verdadera, sino a lo sumo «no refutada».
Explanation:
Si no es posible refutarla, dicha teoría queda «corroborada», pudiendo ser aceptada provisionalmente, pero no verificada; es decir, ninguna teoría es absolutamente verdadera, sino a lo sumo «no refutada».
does skim milk contain roughage?
The complementary DNA sequence of AATTGGCC is
TTAACCGG
AATTGGCC
GGCCAATT
ATATGCGC
Answer:
TtAaccgg
nznzn
Explanation:
nnsjsbsjjzhz
The substances that are present after any chemical reaction are called what?
The substance that are present after any chemical
reaction are called as products
Nitrogen is an essential nutrient for plant growth. But farmers who cultivate pulse crops like Green gram, Bengal gram, Black gram etc., do not apply Nitrogenous Fertilizers during cultivation. Why?
Answer:
Nitrogen is so vital because it is a major component of chlorophyll.Nitrogen is the fuel that makes plants go. It's used to synthesize amino acids, proteins, chlorophyll, nucleic acids, and enzymes. Plants need more nitrogen than any other element.Farmers who cultivate pulse crops like green gram, Bengal gram, black gram, etc. do not apply nitrogenous fertilizers during cultivation because these crops have "rhizobium bacteria".
These plants are leguminous plants and they have symbiotic relationship with Rhizobium bacteria. This bacteria converts atmosphere nitrogen in a form that the plant can use, in return the plant provide them shelter and food. That's why they don't need extra nitrogen from fertilizers.
Why does prolonged exposure to UV light from the Sun or tanning beds increase the risk for getting skin cancer?
increased exposure to UV light decreases the risk of a mutation occurring
increased exposure to UV light increases the risk of a mutation occurring
increased exposure to UV light decreases the immune system function
increased exposure to UV light has no effect on the risk for getting skin cancer
Answer:
it increases chance of mutation of unrepaired skin cells that add up and create a tumoer
Explanation:
Answer:
B.) increased exposure to UV light increases the risk of a mutation occurring
Explanation:
I made 100% on the Chromosomal Changes quiz!
How does carbon cycle through Earth's systems? A. As fossil fuels are burned, carbon dioxide is made available for photosynthesis in animal cells. When the animals die, carbon is released into the soil, and the animal remains form new fossil fuels. B. Animals absorb carbon dioxide through their skin. Dead animals release carbon into the soil. Plants absorb the carbon from the soil and release carbon dioxide during photosynthesis. C. Plants absorb carbon dioxide through their leaves. Animals take in the carbon when they eat the plants. Animals exhale carbon dioxide. Dead plants and animals release carbon into the soilling D. Photosynthesis releases carbon dioxide into the atmosphere Cellular respiration uses carbon dioxide
Answer:
D. Photosynthesis releases carbon dioxide into the atmosphere Cellular respiration uses carbon dioxide.
Explanation:
Carbon dioxide is taken out of the air by the photosynthesis process to make carbon food for crops.
Animals and plants need a mechanism called respiration to remove carbon dioxide gas.
When combustibles are burned, carbon flows from fossil fuels to the air.
Where can food get broken down? Select all that apply.
A. in the stomach
B. in the mouth
C. in the small intestine
Answer:
The answers are A. and B.
Explanation:
Digestion starts in the mouth when you chew, then the acids in your stomach break the food down further.
Three babies were mixed up in a hospital. After consideration of the data below, which of the following represent the correct baby and parent combinations?
Couple # I II III
Blood Groups A and A A and B B and O
Baby # 1 2 3
Blood Groups B O AB
A) I-3, II-1, III-2
B) I-1, II-3, III-2
C) I-2, II-3, III-1
D) I-2, II-1, III-3
E) I-3, II-2, III-1
Answer:
The correct option is C) I-2, II-3, III-1
Couple I, Baby 2Couple II, Baby 3Couple III, Baby 1Explanation:
Due to technical problems, you will find the complete explanation in the attached files
How is blood different after it is pumped through the capillaries in the intestines?
Answer: nutrients are absorbed then it goes into the bloodstream through capillaries. These nutrients include acids, vitamins and fatty acids
Explanation:
the answer is above
what is the meaning of localisation ?
The meaning of localisation is the process of making something local in character or restricting it to a particular place.
Localization is the adaptation of a particular product or service to one of those markets.
... XxMissFlirtyxX...A weak gene that is only seen if there are two of them; i.e. dd
A.genotype
B.phenotype
C. dominant
D.recessive
02:11:13
31
32
33
Kai looks at a photo of herself with her parents. She notices that while her features are similar to her parents features.
they do not appear to be identical.
Which explains why this is the case?
Their DNA is made of different codon sequences.
Their DNA is made of four different bases.
Kai inherited more proteins from one parent than the other.
Kai inherited different amino acids from either of her parents.
Markthanditum
Save and Exit
Next
SER
Answer:
The awnser would be their DNA is made of different codon sequences.
Explanation:
The reason is Kai gets her sequences from both her mom and dad and so do her parents from their parents and on and on.
The statement that best explains the characteristics of Kai with respect to her parents is as follows:
Their DNA is made of different codon sequences.Thus, the correct option is A.
Why Kai does not appear to be identical to her parents?Kai does not appear to be identical to her parents because of the process known as variation. Variations may be defined as the process of differences in traits of individuals of a progeny from each other and from their parents.
The codon that constructs the characteristics of the DNA significantly depends on the triplet of amino acid sequences that alter the formation of proteins which governs all the properties and mechanisms of living organisms including their appearances.
Therefore, the correct option for this question is A.
To learn more about Codons, refer to the link:
https://brainly.com/question/26929548
#SPJ6
Drag each label to the correct location.
Classify the organisms based on what they eat.
Answer:
plants---- producer
trees---- producer
earthworm------decomposer
zebra---- consumer
tiger------- consumer
I don't seem to see the last item there clearly
Answer:
plants---- producer
trees---- producer
earthworm------decomposer
zebra---- consumer
tiger------- consumer
I hope this helps
What kind of community does the photograph show?
A. Mountainous
B. Metropolitan
C. Coastal
D. Rural
Pls help
Answer:
That is a rural community.
The green area on the map shows the rural community. It is an open land with less population, houses and with lots of open spaces. It is rural community in the given image.
What are the types of community?There are so many options to live in a community.
The community can be of following types:
Rural community: Here houses are made very far from each other. It has open land spaces with less density of population.Urban community: These are located in cities. In this type of community, people lives in very close proximity.Suburban community: This community is a mixture of urban and rural community.Thus, the given paragraph is of rural community.
For more details regarding rural community, visit:
https://brainly.com/question/14057728
How is blood different after it is pumped through the capillaries in the intestines?
A. it has less oxygen
B. it has more oxygen
Answer:
B
Explanation:
It has more oxygen blood different after it is pumped through the capillaries in the intestines. Thus the correct option is A.
What is capillaries?Capillaries are delicate blood vessels that exist throughout body. They transport blood, nutrients and oxygen to cells in your organs and body systems. Capillaries are the smallest blood vessels in your vascular system.
Nutrients are absorbed then it goes into the bloodstream through capillaries. These nutrients include acids, vitamins and fatty acids.
For more information regarding capillaries, visit:
https://brainly.com/question/64497
#SPJ2
12. Why do people who are heavy require larger intakes of water? You will get 35 points
Answer: Because they have a bigger blater
Explanation:
which of the following statements are true of the appendicular skeleton. a) The radius articulates with the ulna and the metacarpals. b) One hand contains 14 phalanges and one foot contains 13 phalanges. c) The scapula and clavicle attach the arm to the axial skeleton. d) The two hip bones are fused at the public midline. e) The tibia and fibula are to the leg what the radius and ulna are to the arm. f) The ilium, ischium, and pubis all contribute to the acetabulum to attach the tibia. g) Both the humerus and femur have projections for muscle attachment. h) The calcaneus supports the base of the thumb. i) The proximal tibia is part of the knee joint. j) The foot contains eight carpals and the wrist contains seven tarsals.
Answer:
u should have to short the question bcz its confusing....
Explanation:
You are given the following DNA sequence and have determined that it is the sense parental strand. ATTGCCATGAAACGCCCCGGTACACCATTGTTCGGCAAATAAAAATAA What is the polypeptide sequence of this sense strand? Use the three letter abbreviation and separate the amino acids with a dash - e.g. Trp-Thr-Ala. If there is a stop codon - you may add an asterisk to the sequence - e.g. Trp-Thr-Ala-*
Answer:
* (Stop) - Arg - Cys - Phe - Ala - Gly - Pro - Cys - Gly - Asn - Lys - Pro - Phe - Ile - Phe - Ile
Explanation:
This question involves gene expression, which consists of transcription and translation. The process of transcription involves synthesis of mRNA from DNA template as follows:
DNA - mRNA
ATT - UAA
GCC - CGG
ATG - UAC
AAA - UUU
CGC - GCG
CCC - GGG
GGT - CCA
ACA - UGU
CCA - GGU
TTG - AAC
TTC - AAG
GGC - CCG
AAA - UUU
TAA - AUU
AAA - UUU
TAA - AUU
Using the codon chart, each mRNA codon is translated into an amino acid as follows:
* (Stop) - Arg - Cys - Phe - Ala - Gly - Pro - Cys - Gly - Asn - Lys - Pro - Phe - Ile - Phe - Ile
bacterial spieces that retain the purple dye after decolorizer is added and appear blue or violet are referred to as
Answer:
gram positive is the answer
Explanation:
Once a standard curve has been prepared by plotting numbers of bacteria (CFU/mL) versus absorbance for one species of bacteria, this curve can be used for estimating bacterial numbers by measuring absorbance for any species of bacteria.
a. True
b. False
Answer:
b. False
Explanation:
The biomechanism of bacterial growth may be examined, by graphing cell growth (also known as absorbance) vs incubation time of the bacteria. A standard growth curve is the result of this process. The amount of turbidity in the broth culture is proportional to the number of microorganisms present.
A standard curve produced for a particular species can't be utilized to predict the number of bacterial counts for a different species due to the listed factors.
The rate of bacterial cell reproduction varies from a particular species to another.Varying species have different absorbance thresholds.How much of your dna do you think is the same as your friends dna ?
Answer:
E
Explanation:
Most of our DNA determines that we are human, rather than determining how we are different from any other person. So it is not so surprising that the DNA of any two human beings is 99.9 percent identical.
(a) Describe why DNA replication is said to be a semiconservative process. Explain how random mutations such as those in pathogens with a mutator phenotype may arise in the DNA of an organism.
Answer:
DNA replication is semi-conservative because each helix that is created contains one strand from the helix from which it was copied. The replication of one helix results in two daughter helices each of which contains one of the original parental helical strands.
A mutation is a change that occurs in our DNA sequence, either due to mistakes when the DNA is copied or as the result of environmental factors such as UV light and cigarette smoke. ... Mutations can also occur as the result of exposure to environmental factors such as smoking, sunlight and radiation.
Btw :
stay safe! :3
(a) In order to understand why the replication of DNA is said to be semi conservative, there is a need to understand what really goes on during replication.
During replication, the two strands of the DNA first become separated.Each strand then makes a complementary copy of itself.The original double strand does not reform, instead, the old strands each forms a double strand by coupling with their newly synthesized complimentary strands.The fact that the 2 double strands DNA that forms at the end of the replication process each consist of one old and one newly synthesized strand is why replication is said to be semi conservative. The old strands remain conserved but are now separated into new double strands.
(b) Random mutations such as those in pathogens with a mutator phenotype may arise in the DNA of an organism due to a host of factors:
mistakes during replicationmutation due to external factors such as chemicals, UV radiation, etc.When this happens, the DNA sequence is altered and this alteration creates one or more phenotypic effects.
More on DNA replication and mutation can be found here: https://brainly.com/question/10787
An organism has a haploid number of 20. What is the organism's diploid
number?
Answer:
It is 20!
Explanation:
I did this before