Answer:
Nitrogen is so vital because it is a major component of chlorophyll.Nitrogen is the fuel that makes plants go. It's used to synthesize amino acids, proteins, chlorophyll, nucleic acids, and enzymes. Plants need more nitrogen than any other element.Farmers who cultivate pulse crops like green gram, Bengal gram, black gram, etc. do not apply nitrogenous fertilizers during cultivation because these crops have "rhizobium bacteria".
These plants are leguminous plants and they have symbiotic relationship with Rhizobium bacteria. This bacteria converts atmosphere nitrogen in a form that the plant can use, in return the plant provide them shelter and food. That's why they don't need extra nitrogen from fertilizers.
g Two linked genes, (A) and (B), are separated by 18 centiMorgans. A man with genotype Aa Bb marries a woman who is aa bb. The man's father was AA BB. What is the probability that their first child will both be ab/ab
Answer:
The probability that their first child will both be ab/ab = 41%.
Explanation:
Available data:
Two linked genes (A) and (B) ⇒ 18 centiMorgans apartMan ⇒ Aa BbMan´s father ⇒ AA BBWoman ⇒ aabbThe recombination frequency is given by the distance between genes. We have to know that 1% of recombinations = 1 map unit = 1cm.
Recombination frequency = 0.18
Man: AaBb
Gametes) AB Parental
ab Parental
Ab Recombinant
aB recombinant
18 centi morgan = 18 % of recombination in total
= % aB + % Ab
= 9% aB + 9% Ab
100% - 18% = 82% of parental in total
= % of AB + % ab
= 41% AB + 41% ab
The frequency for each gamete is:
AB 41%
ab 41%
Ab 9%
aB 9%
Cross: man x woman
Parental) AaBb x aabb
Gametes) AB, Ab, aB, ab ab, ab, ab, ab
Punnett square) AB ( 41%) Ab (9%) aB (9%) ab (41%)
ab AaBb Aabb aaBb aabb
ab AaBb Aabb aaBb aabb
ab AaBb Aabb aaBb aabb
ab AaBb Aabb aaBb aabb
F1) 41% of the progeny is expected to be AaBb
9% of the progeny is expected to be Aabb
9% of the progeny is expected to be aaBb
41% of the progeny is expected to be aabb
How does water help drive the rock cycle?
A. It is abundant on Earth's surface.
B. It is an agent of weathering and erosion.
C. It helps Earth maintain a relatively constant temperature.
D. It maintains a liquid state in a relatively narrow range of temperatures
ap3x
Why was the Battle of Bunker Hill important in the war for American independence from Britain? A. The battle was the first important victory for the fledgling Continental Army. B. The battle was the first important victory for General George Washington. C. Although the British ultimately won the battle, they lost their best general. D. Although the British ultimately won the battle, they suffered heavy casualties.
Answer: D. Although the British ultimately won the battle, they suffered heavy casualties.
Explanation: Even though they lost, the colonial forces were able to inflict a substantial amount of damage resulting in lots of casualties.
Plyometrics can help a person maintain cardiorespiratory fitness true or false
Name the main hormone that causes the tropic response movement of pollen tubes towards ovule.
Answer:
Chemotropism
Explanation:
which statement is true of both mitosis and meiosis?
A) The number of
chromosomes is reduced by half.
B) both occur only in reproductive cells.
C) DNA replication occurs before the division of the nucleus.
D) both are involved in asexual reproduction.
Answer:
The statement 'b. both occur only in reproductive cells' is true
Which statement correctly compares mass and weight?
A.Both depend on the force of gravity pulling on an object B.The basic unit of both is the kilogram C.Both mass and weight ofan object would be less on the moon than on Earth D.Weight varies with location, but mass does not vary
Answer:
D. Weight varies with location, but mass does not vary
Explanation:
Weight can be defined as the force acting on a body or an object as a result of gravity.
Mathematically, the weight of an object is given by the formula;
[tex] Weight = mg [/tex]
Where;
m is the mass of the object.g is the acceleration due to gravity.Mass can be defined as a measure of the amount of matter an object or a body comprises of. The standard unit of measurement of the mass of an object or a body is kilograms.
Irrespective of the location of an object or a body at a given moment in time, the mass (amount of matter that they're made up of) is constant. This ultimately implies that, whether you're in the moon, space, earth or any other place, your mass remains the same (constant).
Hence, the statement that correctly compares mass and weight is that, weight varies with location, but mass does not vary. This is simply because acceleration due to gravity changes with location i.e its value varies with the planets.
During Meiosis, an important event occurs where the chromosomes that you inherited from your mom exchange pieces with the chromosomes you inherited from your dad. This process is called:
a. Genetic Exchange
b. Recombination
c. Synapsis
d. Crossing Over
Answer:
Hi, there your answer is D.Crossing Over
Hope This Helps
PLZ CORRECT ME IF I AM WRONG :)
Explanation:
Biology
what is carbohydrates
Answer:
Simple carbohydrates are broken down quickly by the body to be used as energy. Simple carbohydrates are found naturally in foods such as fruits, milk, and milk products. They are also found in processed and refined sugars such as candy, table sugar, syrups, and soft drinks.
Fat cells are expandable. How does this structure relate to a fat cell's function?
A) Fat cells store energy for the body to use later, so being
expandable would help with storage.
B) Fat cells burn energy quickly when other food source is available, so being expandable would help with the rapid burn.
C) Fall cells protect organs, so being expandable can help with cushioning.
D) Fat cells do not expand
Answer:
Explanation:
d
Which of the following describes the products of mitosis?
two unique cells
one cell identical to the parent
cell death
two daughter cells that have identical DNA to the parent
Answer:
The products of mitosis are two diploid cells, whereas the products of meiosis are four haploid cells. -Mitosis and meiosis both begin with duplicated chromosomes. -In mitosis the daughter cells are genetically identical, but in meiosis the daughter cells are genetically varied.
Explanation:
Which process is characterized by the movement of particles from an area of high concentration to an area of low concentration across the plasma membrane without the use of energy?
1) hypertonic transport
2) active transport
3) passive transport
4) dynamic equilibrium
Answer:
3) passive transport
Explanation:
Passive transport is a type of cellular transport that does not require the use of energy to move substances (i.e., ions and molecules) across biological membranes. Passive transport uses concentration gradients to move substances across cell membranes, thereby transporting them from regions of high concentration to regions of low concentration. Passive transport can be divided into 1-osmosis (i.e., movement of solvents), 2-diffusion (i.e., movement of solutes), and 3-facilitated diffusion (i.e., movement of molecules with help of protein channels or carriers), and 4-filtration (i.e., movement of water by using a pressure gradient).
Answer: moves particles from on area of low concentration to an area of high concentration
Explanation: Active transport differs from passive transport because active transport
can only move particles into the cell.
does not require energy to transport particles.
moves particles from an area of low concentration to an area of high concentration.
depends on the random movements of particles to carry them across the membrane.
EDG2023
ALL of the following are applicable only
in the United States EXCEPT
A. Clean Water Act
B. Safe Drinking Water Act
C. Marine Protection, Research, and Sanctuaries Act
D. London Convention on the Prevention of Marine
Pollution
Answer:
the answer is C. Marine protection, research and sanctuaries Act.
Which of the following is not a true statement of the lungs?
Answer: The right lung is shorter and wider than the left lung, and the left lung occupies a smaller volume than the right.
The lung houses structures of both the conducting and respiratory zones.
The left lung consists of three lobes.
The lungs exchange respiratory gases across a very large epithelial surface area—about 70 square meters
Explanation:
what type of food is made during photosynthesis
Answer:
glucose
Explanation:
Plants, unlike animals, can make their own food. They do this using a process called photosynthesis . During photosynthesis, plants produce glucose from simple inorganic molecules - carbon dioxide and water - using light
(bbc)
1. Indicate patient history details that are consistent with the patient having an infection. How do the patient’s signs and symptoms compare to a healthy individual?
2. Indicate what you suspect might be the etiological agent. What additional history would you like to have?
3. Based on the microbe you suspect is responsible for the symptoms, from which body sites would you recommend taking culture?
4. . Give culture and test characteristics of the microbe you suspect might be causing the disease. If you suspect more than one might be responsible, how might you distinguish the two?
5. Indicate virulence factors possessed by this microbe that might be responsible for the symptoms. Indicate how it produces the symptoms you observe in the patient.
6. Is this microbe normal microbiota at the culture site?
7. What type of treatment would be used for this patient
Answer:
All the answers are there in the photo
Is there anything we as a society can do to prevent these pandemic from occurring
The only thing you can do now is to try do the necessary pre-causion, which are;
Always wear maskAlways be sanitizedAlways wear hand glovesKeep social distancingWhich is NOT a passive transport mechanism across the membrane of a plant cell?
Which is NOT a passive transport mechanism across the membrane of a plant cell?
Facilitated diffusion
Diffusion
Osmosis
Receptor-mediated endocytosis
Answer:
the company has also announced plans
This is the type of succession that
occurs when all of the usable soil
has been destroyed in an
ecosystem.
A seccession
B primary
C Secondary
C. Secondary Succession
The process of an ecosystem returning to its stable form after a disaster is known as secondary succession.
This happens faster than primary succession because the soil is already formed and nutrients are more available at the beginning of the process.
Hope it helps you! ＼(^ᴥ^)／
Secondary is the type of succession that occurs when all of the usable soil has been destroyed in an ecosystem.
What is a succession?Succession is the process of change and development that occurs in an ecosystem over time. It refers to the gradual replacement of one community of plants and animals with another, as each community modifies the physical and biological environment in which it lives. There are two main types of succession: primary succession and secondary succession.
Primary succession occurs in an ecosystem that has no soil or vegetation, such as on newly formed volcanic islands or in areas where glaciers have retreated. During primary succession, the ecosystem must develop from scratch, with the creation of new soil and the establishment of new plant and animal communities. This process can take a significant amount of time.
Secondary succession occurs when all of the usable soil has been destroyed in an ecosystem. This type of succession can occur after a natural disaster, such as a fire or a flood, or after human activity, such as logging or farming. During secondary succession, the ecosystem must rebuild itself from scratch, with new soil being created and new plant and animal communities establishing themselves. This process can also take a significant amount of time, depending on the severity of the disturbance and the conditions of the ecosystem.
Learn more about succession, here:
https://brainly.com/question/26675203
#SPJ2
How does your model support the claim that
the Northern and Southern Hemispheres
have different seasons?
Answer:
Due to presence on opposite side of the globe.
Explanation:
My model support the claim that the Northern and Southern Hemispheres have different seasons due to present on different location on the globe. The seasons in the Northern Hemisphere are different and opposite of those in the Southern Hemisphere. Seasons occur because Earth is tilted on its axis. This tilting causes summer in one location whereas winter in other location. The Earth's tilt causes the Southern Hemisphere to lean towards the Sun during summer season of Southern Hemisphere while on the other hand, it is winter season in the Northern Hemisphere which leans away from the Sun.
A forest fire destroys an area. A small population of trees and a large population of birds are both affected. Which type
of limiting factor causes this?
density dependent
density independent
population dependent
population independent
Answer:
B. DENSITY INDEPENDENT
Explanation:
Density independent is a limiting factor. It affect birth and death rates of organisms through abiotic and environmental factors. A forest fire is one of the environmental factors that affects the density of a species in a given location.
The most diverse community would typically found in
Habitat 1
Habitat 2
Habitat 3
Non of the above
The sun is a natural resource used by people. Why is the sun considered a renewable resource? *
the sun goes away at night and then comes back in the morning
on cloudy days, the sun cannot be used
solar energy from the sun is limited
the sun is an unlimited source of energy that isn't used up as fast as people use it
Answer:
Because the earth continuously receives solar energy from the sun, it is considered a renewable resource.
Explanation:
Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first C): ATGCTGCGAAACTTTGGCTGA Provide the 6 DNA codons that would be read following the mutation. Are they the same as the original 6 DNA codons that would have been read
Answer:
Codons after the mutation are not exactly the same as before mutation, because one base was deleted, changing the sequence of codons.
Codons before mutation: ATG TGC GAA ACT TTG GCT
Only the first one (ATG) might coincide with one of the codons before mutation.
Explanation:
Genetic information for the aminoacids assembly during the protein synthesis is stored in short sequences of three nucleotides named codons in the DNI or mRNA. Each of the codons represents one of the 20 amino acids used to build the protein. There are a total of 64 codons. 61 codify amino acids, one of these amino acids is also the start point of protein synthesis, and the left three codons are stopping translation points.
The Sequence before mutation ATGCTGCGAAACTTTGGCTGA
Codons: ATG CTG CGA AAC TTT GGC TGA
The Sequence after mutation ATGTGCGAAACTTTGGCTGA
Codons: ATG TGC GAA ACT TTG GCT
Only the first one (ATG) might coincide with one of the codons before mutation.
I’ll Venmo u 5 dollars if u help me. I have a human made for of pollution and natural form of pollution. I have to pick which one is human and natural
Which is a positive effect of wildfires?
Answer: it lets for room for more buildings to be built
Explanation:
If the number of births and deaths in a given time are equal, then the population size will be stable. True or False?
Answer:
True
Explanation:
Because for each death someone is born
It's like 1+1+1-1-1=1
The answer is the same
John Needham, Louis Pasteur, and other scientists all performed experiments to disprove ______.
a) spontaneous generation
b) evolution
c) Koch's postulates
d) binomial nomenclature
Answer:
A) spontaneous generation
Explanation:
Spontaneous Generation theory stated that living organisms could be spontaneously generated from non-living matter. Francesco Redi conducted an experiment similar to the one Louis Pasteur would do nearly 200 years later. The 17th-century Italian developed a spontaneous generation experiment that showed that maggots do not spontaneously emerge from decaying meat.
MARK THIS ANSWER BRAINLIEST PLEASE ❤️
The theory of spontaneous generation is an experiment that tries to prove the possibilities that living organisms can be produced from non-living origins.
This experiment was first done by Francesco Redi in 1668. However, several scientists such as John Needham, Louis Pasteur, John Tyndall amongst other scientist tried to disprove the theory of spontaneous generation.
The theory was later disproved by Louis Pasteur and John Tyndall in the mid-19th century.
Read more about spontaneous generation at:
https://brainly.com/question/2003717
Which of the following could occur as the result of runoff of high nitrogen fertilizers from farmlands near a lake?
O an increase in algae growth resulting in low oxygen levels in the lake
O a decrease in mineral storage reducing carbon levels of the lake
O a decrease in pollution in lower ozone levels in the lake area
O an increase in deforestation reducing animal populations in the lake area
Answer: the first one an increase in aldae
Explanation:
During a storm, heavy rain ___________ a large rock into smaller pieces and then those pieces are __________ downstream from one place to another. *
erodes / weather
deposits / eroded
weathered / eroded
discharges / deposits
Answer:
1) erodes
2)deposits
Explanation:
